Replication of Feline Syncytial Virus in Feline T‐Lymphoblastoid Cells and Induction of Apoptosis in the Cells

Ikeda, Yasuhiro; Itagaki, Shin Ichi; Tsutsui, Shigeki; Inoshima, Yasuo; Fukasawa, Masashi; Tomonaga, Keizō; Tohya, Yukinobu; Maeda, Ken; Mochizuki, Masahito; Miyazawa, Takayuki; Mikami, Takeshi

doi:10.1111/j.1348-0421.1997.tb01875.x

Cited by 17 publications

(9 citation statements)

References 18 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…A similar infection of simian MSCs with simian foamy virus was previously described in primates [29]. FFV replication is associated with syncytial cell formation, decreased proliferation rate, and finally, cell death [28]. We expand the description of FFV infection to primary fMSC lines and report that FFV infection is the direct cause of the cytopathic effect.…”

Section: Discussionsupporting

confidence: 60%

“…Our work supports the observation that FFV can be noted in 20%-80% of cat cell lines. In addition, FFV is known to induce syncytial cell formation, inhibit cell growth, and induce apoptosis in cultured cells [28]. A similar infection of simian MSCs with simian foamy virus was previously described in primates [29].…”

Section: Discussionmentioning

confidence: 71%

“…FFV can establish latent infection in the host and then induce syncytial cell formation and apoptosis in cultured cells [27,28]. Moreover, previous reports have detailed similar effects of simian foamy virus infection in monkey MSCs [29].…”

mentioning

confidence: 86%

See 2 more Smart Citations

Feline Foamy Virus Adversely Affects Feline Mesenchymal Stem Cell Culture and Expansion: Implications for Animal Model Development

Arzi

Kol

Murphy

et al. 2015

Stem Cells and Development

View full text Add to dashboard Cite

Mesenchymal stem cells (MSCs) are a promising therapeutic option for various immune-mediated and inflammatory disorders due to their potent immunomodulatory and trophic properties. Naturally occurring diseases in large animal species may serve as surrogate animal models of human disease, as they may better reflect the complex genetic, environmental, and physiologic variation present in outbred populations. We work with naturally occurring diseases in large animal species to better understand how MSCs work and to facilitate optimal translation of MSC-based therapies. We are investigating the use of MSC therapy for a chronic oral inflammatory disease in cats. During our efforts to expand fat-derived feline MSCs (fMSCs), we observed that*50% of the cell lines developed giant foamy multinucleated cells in later passages. These morphologic alterations were associated with proliferation arrest. We hypothesized that the cytopathic effects were caused by infection with a retrovirus, feline foamy virus (FFV). Using transmission electron microscopy, polymerase chain reaction, and in vitro assays, we determined that syncytial cell formation and proliferation arrest in fMSCs were caused by FFV strains that were highly homologous to previously reported FFV strains. We determined that the antiretroviral drug, tenofovir, may be used to support ex vivo expansion and salvage of FFV-infected fMSC lines. MSC lines derived from specific pathogen-free cats do not appear to be infected with FFV and may be a source of allogeneic fMSCs for clinical application. FFV infection of fMSC lines may hinder large-scale expansion of autologous MSC for therapeutic use in feline patients.

show abstract

Section: Discussionsupporting

confidence: 60%

Section: Discussionmentioning

confidence: 71%

See 1 more Smart Citation

Feline Foamy Virus Adversely Affects Feline Mesenchymal Stem Cell Culture and Expansion: Implications for Animal Model Development

Arzi

Kol

Murphy

et al. 2015

Stem Cells and Development

View full text Add to dashboard Cite

show abstract

“…By decreasing the amount of SU glycoprotein expression, FVs may minimize the level not only of syncytium formation but also of apoptosis, which has been demonstrated with FV infections of cells (16,23). Another possibility is that by directing the major site of assembly intracytoplasmically, FVs temporarily escape immune detection, thereby giving the virus an important advantage early in the replication cycle.…”

Section: Discussionmentioning

confidence: 99%

An Endoplasmic Reticulum Retrieval Signal Partitions Human Foamy Virus Maturation to Intracytoplasmic Membranes

Goepfert

Shaw

Wang

et al. 1999

J Virol

View full text Add to dashboard Cite

Among all retroviruses, foamy viruses (FVs) are unique in that they regularly mature at intracytoplasmic membranes. The envelope glycoprotein of FV encodes an endoplasmic reticulum (ER) retrieval signal, the dilysine motif (KKXX), that functions to localize the human FV (HFV) glycoprotein to the ER. This study analyzed the function of the dilysine motif in the context of infectious molecular clones of HFV that encoded mutations in the dilysine motif. Electron microscopy (EM) demonstrated virion budding both intracytoplasmically and at the plasma membrane for the wild-type and mutant viruses. Additionally, mutant viruses retained their infectivity, but viruses lacking the dilysine signal budded at the plasma membrane to a greater extent than did wild-type viruses. Interestingly, this relative increase in budding across the plasma membrane did not increase the overall release of viral particles into cell culture media as measured by protein levels in viral pellets or infectious virus titers. We conclude that the dilysine motif of HFV imposes a partial restriction on the site of viral maturation but is not necessary for viral infectivity.

show abstract

“…1B a, d).. The virus titre was measured daily for 7 days using a CPE assay with end-points reported as TCID 50 (Ikeda et al , 1997 ). Cell-free supernatants from pSKY3.0-, pSKY4.0- and pSKY5.0-transfected CRFK cells yielded approximately 10 2 TCID 50 after 30 h. After infection with supernatants from transfected cells, titres of SKY3.0 and -5.0 parental viruses at day 3 were 10 6 and 10 3 TCID 50 /ml, respectively (Fig.…”

Section: Full Textmentioning

confidence: 99%

Isolation and sequencing of infectious clones of feline foamy virus and a human/feline foamy virus Env chimera

Hatama

Otake

Omoto

et al. 2001

Journal of General Virology

Self Cite

View full text Add to dashboard Cite

Full-lengthThe genomic DNA of feline foamy virus (FFV) contains structural genes designated gag, pol and env, as well as the auxiliary gene bel (Helps & Harbour, 1997). These genes are located between two long terminal repeats (LTRs). Although this type of genome organization is common for foamy viruses (FVs) from several species of mammals, there are remarkable dissimilarities between FVs and other retroviruses in their mode of replication (Yu et al., 1996). For example, interactions between group-specific antigen (Gag) and envelope protein (Env) are essential for the assembly and budding of infectious FV particles (Pietschmann et al., 1999), whereas the Gag protein alone is sufficient to allow budding in cells infected with retroviruses other than FVs (Linial, 1999). Reports indicate that it is difficult to produce high titre pseudotyped FV bearing Author for correspondence : Yoichi Fujii.Fax j81 52 836 3430. e-mail fatfuji!hotmail.com glycoproteins from murine leukaemia virus Env or vesicular stomatitis virus G proteins (Lindemann et al., 1997 ;Hill et al., 1999). These observations indicate that the interaction between FV Gag and Env of different species of origin may be of interest when evaluating FVs as vector candidates for gene transfer. We report the isolation and sequencing of FFV clones SKY3.0 and SKY5.0. Furthermore, we show that a chimeric FFV clone (HFFV) bearing Env and a part of the trans-activator (Tas) from human foamy virus (HFV) can infect and replicate in HFV-susceptible cells.Coleman, S7801 and Sammy-1 strains of FFV were grown as described previously (Hatama et al., 2001). Crandell feline kidney (CRFK) cells were infected with each FFV strain, and total DNA was extracted using the Total DNA Extraction kit (Stratagene) according to the manufacturer's instructions. Preliminary experiments revealed that the extracted DNA contained a number of circular forms of unintegrated viral DNA which contained single LTRs. To construct the infectious clones, pSKY1.0 and pSKY2.0, the extracted DNA was amplified by PCR using two primer pairs, 5h agctgatgatccaagtgatgttgcttccc 3h (nt 10239-10267 in the FUV genome ; accession no. Y08851) and 5h cgactcatcctgagttgcatgttgacata 3h (nt 6395-6423), and 5h ggaatggaatgctcacaaacaactacaga 3h (nt 6357-6385) and 5h ctagggaccttaccttactgaggaaggat 3h (nt 1415-1443). Amplified DNAs were cloned into pCR2.1 (Invitrogen) to give two clones designated as 5hLTR-gag-pol (pSKY1.0) and env-bel-3hLTR (pSKY2.0). To construct the fulllength Coleman clone, pSKY3.0, the SalI and SpeI doubledigested fragment of pSKY2.0 was inserted into pSKY1.0 after digestion of the plasmid with the same enzymes. A similar procedure was used to construct the full-length S7801 clone, pSKY5.0. The DNA sequences of the FFV clones, pSKY3.0 (accession no. AB052796) and pSKY5.0 (accession no. AB052797) were determined using a DSQ-2000L DNA sequencer (Shimazu Co.). The Coleman and S7801 clones were 11 694 and 11 660 bp in length. Comparisons of the putative Gag, Pol, Env, Bel I and Bel II amino acid sequences b...

show abstract

Replication of Feline Syncytial Virus in Feline T‐Lymphoblastoid Cells and Induction of Apoptosis in the Cells

Cited by 17 publications

References 18 publications

Feline Foamy Virus Adversely Affects Feline Mesenchymal Stem Cell Culture and Expansion: Implications for Animal Model Development

Feline Foamy Virus Adversely Affects Feline Mesenchymal Stem Cell Culture and Expansion: Implications for Animal Model Development

An Endoplasmic Reticulum Retrieval Signal Partitions Human Foamy Virus Maturation to Intracytoplasmic Membranes

Isolation and sequencing of infectious clones of feline foamy virus and a human/feline foamy virus Env chimera

Contact Info

Product

Resources

About