PCR as a rapid and sensitive tool in the diagnosis of human and canine leishmaniasis using Leishmania donovani s.l.-specific kinetoplastid primers

Abstract

This study was performed in order to test the efficacy of a new polymerase chain reaction (PCR) assay for the diagnosis of both human and canine leishmaniasis caused by Leishmania infantum. The new primers were developed on the basis of a complete DNA sequence of the L. infantum kinetoplast minicircle. Specificity and sensitivity were evaluated by testing bone marrow spots on filter paper and skin biopsy samples, and the PCR results were compared to data from in vitro cultures. Leishmania strains from different foci, as well as other trypanosomatids and opportunistic pathogenic micro-organisms, were also included in this study. The results show that the primers are highly specific, detecting only L. donovani s.l. DNA, and sensitive for the detection of parasite DNA in biological samples from three different geographical regions of Portugal (north, centre and south) and from Brazil.

Serodiagnosis of visceral and cutaneous leishmaniasis in human and canine populations living in Indigenous Reserves in the Brazilian Amazon Region

“…The sample of L. infantum chagasi 13 was isolated from bone marrow aspirate from a naturally infected dog in the municipality of Olympia, São Paulo, and was characterized using molecular methods 14,15 . The parasites were cultured in Roswell Park Memorial Institute (RPMI) liquid medium supplemented with 10% heat-inactivated fetal bovine serum and, after two to three passages, the promastigote forms in the stationary phase of culturing were centrifuged at 735g for 10 minutes and the supernatant was discarded.…”

Design of primer pairs for species-specific diagnosis of Leishmania (Leishmania) infantum chagasi using PCR

“…Since 1998, the polymerase chain reaction (PCR) has been increasingly applied as an alternative method for diagnosing visceral leishmaniasis (TELLERIA et al, 1999;BRANDÃO-FILHO et al, 2003;CORTES et al 2004;ANDRADE et al, 2006;GOMES et al, 2007;SALAM et al, 2010). Additional use of restriction enzymes on the kDNA-PCR product has been adapted by some researchers in order to demonstrate different fragment length polymorphisms (RFLPs) in the genus Leishmania (VOLPINI et al 2004;ANDRADE et al, 2006).…”

“…Because of the high sensitivity of the PCR technique, it is suitable for diagnostic purposes. The sensitivity and specificity of the PCR are directly related to the set of primers used for amplification of the target DNA, the number of copies of the target DNA to be amplified, the DNA extraction method used, the type of material to be analyzed and the PCR protocol (CORTES et al, 2004;SALAM et al, 2010).…”

Molecular evidence of early vertical transmission of Leishmania ( Leishmania ) infantum in a dog

“…Positive qPCR samples were further tested by means of cPCR using the primers MC1 (5'GTTAGCCGATGGTGGTCTTG3') and MC2 (5'CACCCATTTTTCCGATTTTG3') (CORTES et al, 2004). Amplicons (embryo and uterine body) were then purified using the Qiaex II kit (Qiagen ® , Hilden, Germany) and sequenced in both directions by means of Sanger's method (SANGER et al, 1977) in an automated sequencer (ABI-3130; Applied Biosystems).…”