Cloning, Chromosomal Localization, and Physical Linkage of the β and γ Subunits (SCNN1B and SCNN1G) of the Human Epithelial Amiloride-Sensitive Sodium Channel

Voilley, Nicolas; Bassilana, Frédéric; Mignon, C.; Merscher, Sandra; Mattéi, M. G.; Carle, George F; Lazdunski, Michel; Barbry, Pascal

doi:10.1006/geno.1995.1188

Cited by 74 publications

(36 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Heteromultimeric association of homologous subunits is commonly found with ion channels (22,23) and might be the link between the DRASIC subunit and the sustained non-selective current recorded in sensory neurons. Furthermore, relatives of DRASIC, the amiloride-sensitive Na ϩ channel (13,15,16,18) and the degenerins of Caenorhabditis elegans (19), even require several homologous subunits for correct function, and it would be surprising if this would not be the case for the H ϩ -gated cation channels. ASIC, that is also expressed in sensory neurons (7), is not the missing partner of 3.…”

Section: Resultsmentioning

confidence: 99%

Molecular Cloning of a Non-inactivating Proton-gated Na+ Channel Specific for Sensory Neurons

Waldmann

Bassilana

Weille

et al. 1997

Journal of Biological Chemistry

498

464

View full text Add to dashboard Cite

We have cloned and expressed a novel proton-gated Na ؉ channel subunit that is specific for sensory neurons. In COS cells, it forms a Na ؉ channel that responds to a drop of the extracellular pH with both a rapidly inactivating and a sustained Na ؉ current. This biphasic kinetic closely resembles that of the H ؉ -gated current described in sensory neurons of dorsal root ganglia (1). Both the abundance of this novel H؉ -gated Na ؉ channel subunit in sensory neurons and the kinetics of the channel suggest that it is part of the channel complex responsible for the sustained H ؉ -activated cation current in sensory neurons that is thought to be important for the prolonged perception of pain that accompanies tissue acidosis (1, 2).Many painful inflammatory and ischemic conditions are accompanied by a decrease of the extracellular pH (2, 3). H ϩ -gated cation channels are present in sensory neurons (1, 4 -6), and it is likely that those acid-sensing ion channels are the link between tissue acidosis and pain. We recently cloned a rapidly inactivating H ϩ -gated cation channel ASIC 1 (7) (acid-sensing ion channel). Fast inactivating H ϩ -gated cation currents were described in neurons of the central nervous system (6,8,9) and in sensory neurons (4 -6), tissues where ASIC is well expressed (7). However, rapidly inactivating H ϩ -gated cation channels cannot account solely for the prolonged sensation of pain that accompanies tissue acidosis. Sensory neurons respond to a drop in pH with a rapidly inactivating followed by a sustained current, which is thought to mediate the non-adaptive pain caused by acids (1). Here we describe the cloning of a H ϩ -gated cation channel specific for sensory neurons that has both a rapidly inactivating and a sustained component. MATERIALS AND METHODSCloning of DRASIC-We used an anchored PCR approach to identify the sequences upstream and downstream of the expressed sequence tag (W62694). An double stranded adapter (anchor) was prepared by annealing the oligonucleotides GATTTAGGTGACACTATAGAATCGA-GGTCGACGGTATCCAGTCGACGAATTC and PO 4 -GAATTCGTCGA-CTG-NH 2 . The shorter oligonucleotide was protected with a 3Ј NH 2 group to avoid extension during the PCR reaction. This adapter was ligated to double stranded rat brain cDNA resulting in a cDNA with known sequences (the anchor) on both extremities. The so prepared anchored cDNA was used to amplify the 5Ј and the 3Ј end of the coding sequence by PCR. This was done using either the primer GATTTAG-GTGACACTATAGAA or TAGAATCGAGGTCGACGGTATC, which are identical to parts of the longer of the two adapter oligonucleotides together with either the sense primer (CACTACACGCTATGCCAAGG, for amplification of the 3Ј end) or the antisense primer (CCCAG-CAACTCCGACACTTC, for amplification of the 5Ј end) complementary to the expressed sequence tag (W62694). The PCR products were subcloned into Bluescript, and five clones each for the 5Ј PCR and for the 3Ј PCR were sequenced. The anchored PCR allowed us to identify the sequences upstream of the first ATG codon and down...

show abstract

Section: Resultsmentioning

confidence: 99%

Molecular Cloning of a Non-inactivating Proton-gated Na+ Channel Specific for Sensory Neurons

Waldmann

Bassilana

Weille

et al. 1997

Journal of Biological Chemistry

498

464

View full text Add to dashboard Cite

show abstract

“…The single-tube competitive RT-PCR technique previously described (24) was applied by using oligonucleotide primers designed from the human ␥ENaC gene sequence (25), as reported in Table I. The homologous competitor for human ␥ENaC mRNA (c␥EnaC) was obtained by RT of total RNA from human bronchial epithelial cells with primer ␥ENaC-R1, followed by amplification with primers ␥ENaC-D1 and ␥ENaCD‫,ء‬ which generated a 7-bp deletion with respect to the wild-type sequence.…”

Section: Quantitation Of ␥Enac Mrna By Competitive Rt-pcrmentioning

confidence: 99%

IL-4 Is a Potent Modulator of Ion Transport in the Human Bronchial Epithelium In Vitro

Galietta

Pagésy

Folli

et al. 2002

The Journal of Immunology

125

123

View full text Add to dashboard Cite

Recent data show that proinflammatory stimuli may modify significantly ion transport in the airway epithelium and therefore the properties of the airway surface fluid. We have studied the effect of IL-4, a cytokine involved in the pathogenesis of asthma, on transepithelial ion transport in the human bronchial epithelium in vitro. Incubation of polarized bronchial epithelial cells with IL-4 for 6–48 h causes a marked inhibition of the amiloride-sensitive Na+ channel as measured in short circuit current experiments. On the other hand, IL-4 evokes a 2-fold increase in the current activated by a cAMP analog, which reflects the activity of the cystic fibrosis transmembrane conductance regulator (CFTR). Similarly, IL-4 enhances the response to apical UTP, an agonist that activates Ca2+-dependent Cl− channels. These effects are mimicked by IL-13 and blocked by an antagonist of IL-4Rα. RT-PCR experiments show that IL-4 elicits a 7-fold decrease in the level of the γ amiloride-sensitive Na+ channel mRNA, one of the subunits of the amiloride-sensitive Na+ channel, and an increase in CFTR mRNA. Our data suggest that IL-4 may favor the hydration of the airway surface by decreasing Na+ absorption and increasing Cl− secretion. This could be required to fluidify the mucus, which is hypersecreted during inflammatory conditions. On the other hand, the modifications of ion transport could also affect the ion composition of airway surface fluid.

show abstract

“…ENaC is a heterotrimeric channel comprising three homologous subunits, a-, b-, and c-, each of which shares about 35% amino acid sequence homology (McDonald et al, 1994;Voilley et al, 1994;McDonald et al, 1995;Voilley et al, 1995). The alpha subunit (aENaC) is the major pore forming subunit, and beta-and gamma-subunits mediate degradation of the channel (Benos et al, 1996;Awayda et al, 1997;Garty and Palmer, 1997;Alvarez de la Rosa et al, 2000).…”

Section: Introductionmentioning

confidence: 99%

The epithelial sodium channel mediates the directionality of galvanotaxis in human keratinocytes

Yang

Charles

Hummler

et al. 2013

Journal of Cell Science

View full text Add to dashboard Cite

SummaryCellular directional migration in an electric field (galvanotaxis) is one of the mechanisms guiding cell movement in embryogenesis and in skin epidermal repair. The epithelial sodium channel (ENaC), in addition to its function of regulating sodium transport in kidney, has recently been found to modulate cell locomotory speed. Here we tested whether ENaC has an additional function of mediating the directional migration of galvanotaxis in keratinocytes. Genetic depletion of ENaC completely blocks only galvanotaxis and does not decrease migration speed. Overexpression of ENaC is sufficient to drive galvanotaxis in otherwise unresponsive cells. Pharmacologic blockade or maintenance of the open state of ENaC also decreases or increases, respectively, galvanotaxis, suggesting that the channel open state is responsible for the response. Stable lamellipodial extensions formed at the cathodal sides of wild-type cells at the start of galvanotaxis; these were absent in the ENaC knockout keratinocytes, suggesting that ENaC mediates galvanotaxis by generating stable lamellipodia that steer cell migration. We provide evidence that ENaC is required for directional migration of keratinocytes in an electric field, supporting a role for ENaC in skin wound healing.

show abstract

Cloning, Chromosomal Localization, and Physical Linkage of the β and γ Subunits (SCNN1B and SCNN1G) of the Human Epithelial Amiloride-Sensitive Sodium Channel

Cited by 74 publications

References 0 publications

Molecular Cloning of a Non-inactivating Proton-gated Na+ Channel Specific for Sensory Neurons

Molecular Cloning of a Non-inactivating Proton-gated Na+ Channel Specific for Sensory Neurons

IL-4 Is a Potent Modulator of Ion Transport in the Human Bronchial Epithelium In Vitro

The epithelial sodium channel mediates the directionality of galvanotaxis in human keratinocytes

Contact Info

Product

Resources

About