Assessing Mouse Islet Function

Atanes, Patricio; Ruz‐Maldonado, Inmaculada; Olaniru, Oladapo E.; Persaud, Shanta J.

doi:10.1007/978-1-0716-0385-7_17

Cited by 12 publications

(25 citation statements)

References 18 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Islets were cultured for 1 day. Insulin secretion and content were measured as previously described in detail ( 11 ). Briefly, islets were preincubated for 1 h in RPMI medium containing 2 mmol/L glucose.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

The KINGS Ins2+/G32S Mouse: A Novel Model of β-Cell Endoplasmic Reticulum Stress and Human Diabetes

et al. 2020

View full text Add to dashboard Cite

Act 1986 with 2012 amendments. The KINGS mice (C57BL/ 6J-Ins2,Kings.; Mouse Genome Informatics [MGI]: 6449740) were discovered in a colony with a C57BL/6J background and maintained on this background. Heterozygous males and females were studied from weaning until 20 weeks of age. In one study, KINGS mice were compared with Ins2 1/Akita (Akita) mice, which were obtained from The Jackson Laboratory (stock #003548, MGI: 1857572; Bar Harbor, ME) and maintained on the C57BL/6J background by in-house breeding. All mice were kept in standard laboratory conditions with a 12-h light/dark cycle. They had access to water and standard chow ad libitum, unless otherwise stated. Nesting material, shelters, and tunnels were provided in the cages as enrichment. According to our ethical guidelines, any animal losing 20% body weight was killed. Genotyping Ear clips were digested using lysis buffer (10% 103 Gitschier buffer, 0.5% Triton X-100, 1% b-mercaptoethanol, 2% 50 mg/mL proteinase K). The Kompetitive allele-specific PCR (KASP; LGC, Hoddesdon, U.K.) was used to determine genotype. Forward primers with fluorescent tags corresponding to the wild-type Ins2 (GAAGGTGACCAAGTTCATGCTTTTG TCAAGCAGCACCTTTGTG, FAM fluorophore) and KINGS mutant (GAAGGTCGGAGTCAACGGATTGCTTTTGTCAAG-CAGCACCTTTGTA, HEX fluorophore), with a common reverse primer for Ins2 (AGAGCCTCCACCAGGTGGGAA), were used. PCR was carried out using a LightCycler 480 (Roche, Basel, Switzerland) to give different fluorescent signals corresponding to wild-type, heterozygous, or homozygous genotypes. Animal Monitoring Random morning (9:00 A.M.) blood glucose concentrations and body weights were measured between weaning (3 weeks)

show abstract

Section: Methodsmentioning

confidence: 99%

“…Acidified alcohol was added to islet pellets before sonication and storage until analysis. Insulin secretion and content were measured by in-house radioimmunoassay (described in detail in Atanes et al [ 11 ]).…”

Section: Methodsmentioning

confidence: 99%

The KINGS Ins2+/G32S Mouse: A Novel Model of β-Cell Endoplasmic Reticulum Stress and Human Diabetes

et al. 2020

View full text Add to dashboard Cite

show abstract

“…While these two approaches form the foundation of many islet isolation techniques, there are considerable variations among published methods as well as alternative methods [ 8 , 16 , 20 , 29 , 40 – 43 ]. The advantages of using the common bile duct are twofold: 1) it allows the digestive enzyme to access the islets using the anatomical structures of the pancreas, and 2) stationary digestion reduces mechanical damage to the islets.…”

Section: Procedures Of Islet Isolationmentioning

confidence: 99%

A Practical Guide to Rodent Islet Isolation and Assessment Revisited

et al. 2021

View full text Add to dashboard Cite

Insufficient insulin secretion is a key component of both type 1 and type 2 diabetes. Since insulin is released by the islets of Langerhans, obtaining viable and functional islets is critical for research and transplantation. The effective and efficient isolation of these small islands of endocrine cells from the sea of exocrine tissue that is the rest of the pancreas is not necessarily simple or quick. Choosing and administering the digestive enzyme, separation of the islets from acinar tissue, and culture of islets are all things that must be considered. The purpose of this review is to provide a history of the development of islet isolation procedures and to serve as a practical guide to rodent islet research for newcomers to islet biology. We discuss key elements of mouse islet isolation including choosing collagenase, the digestion process, purification of islets using a density gradient, and islet culture conditions. In addition, this paper reviews techniques for assessing islet viability and function such as visual assessment, glucose-stimulated insulin secretion and intracellular calcium measurements. A detailed protocol is provided that describes a common method our laboratory uses to obtain viable and functional mouse islets for in vitro study. This review thus provides a strong foundation for successful procurement and purification of high-quality mouse islets for research purposes.

show abstract

“…The average age (±SEM) of the donors was 41.7 ± 3.6 years and the body mass index (BMI) was 27.8 ± 1.7 kg/m [2]. Islets were isolated from 8-to 12-week old male Gpr55 −/− C57BL/6J mice and age-matched Gpr55 + / + mice via collagenase injection into the common bile duct [26], yielding~350 islets per mouse. Isolated mouse and human islets were maintained in culture overnight (human: CMRL-1066; mouse: RPMI-1640) at 37 • C, 95% air/5% CO 2 prior to experimentation [27].…”

Section: Isolation Of Human and Mouse Isletsmentioning

confidence: 99%

“…Groups of 55 human or 45 mouse islets were perifused with a physiological salt solution [28] supplemented with 2 mM or 20 mM glucose in the absence or presence of 10 µM JTE 907 using a temperature-controlled perifusion system [27]. Perifusate fractions were collected at 2-min intervals and secreted insulin was quantified by radioimmunoassay [26]. JTE 907 was dissolved to 10 µM in DMSO with a final DMSO concentration of 0.1% (v/v), which was also used as a control (vehicle) in the perifusions with human islets.…”

Section: Dynamic Insulin Secretionmentioning

confidence: 99%

Direct Stimulatory Effects of the CB2 Ligand JTE 907 in Human and Mouse Islets

Ruz‐Maldonado

Atanes

Huang

et al. 2021

Cells

Self Cite

View full text Add to dashboard Cite

Aims: The endocannabinoid system is a complex cell-signaling network through which endogenous cannabinoid ligands regulate cell function by interaction with CB1 and CB2 cannabinoid receptors, and with the novel cannabinoid receptor GPR55. CB1, CB2, and GPR55 are expressed by islet β-cells where they modulate insulin secretion. We have previously shown that administration of the putative CB2 antagonist/inverse agonist JTE 907 to human islets did not affect the insulinotropic actions of CB2 agonists and it unexpectedly stimulated insulin secretion on its own. In this study, we evaluated whether the lack of antagonism could be related to the ability of JTE 907 to act as a GPR55 agonist. Materials and Methods: We used islets isolated from human donors and from Gpr55+/+ and Gpr55−/− mice and quantified the effects of incubation with 10 μM JTE 907 on dynamic insulin secretion, apoptosis, and β-cell proliferation by radioimmunoassay, luminescence caspase 3/7 activity, and immunofluorescence, respectively. We also measured islet IP1 and cAMP accumulation using fluorescence assays, and monitored [Ca2+]i elevations by Fura-2 single cell microfluorometry. Results: JTE 907 significantly stimulated insulin secretion from islets isolated from human donors and islets from Gpr55+/+ and Gpr55−/− mice. These stimulatory effects were accompanied by significant elevations of IP1 and [Ca2+]i, but there were no changes in cAMP generation. JTE 907 also significantly reduced cytokine-induced apoptosis in human and mouse islets and promoted human β-cell proliferation. Conclusion: Our observations show for the first time that JTE 907 acts as a Gq-coupled agonist in islets to stimulate insulin secretion and maintain β-cell mass in a GPR55-independent fashion.

show abstract

Assessing Mouse Islet Function

Cited by 12 publications

References 18 publications

The KINGS Ins2+/G32S Mouse: A Novel Model of β-Cell Endoplasmic Reticulum Stress and Human Diabetes

The KINGS Ins2+/G32S Mouse: A Novel Model of β-Cell Endoplasmic Reticulum Stress and Human Diabetes

A Practical Guide to Rodent Islet Isolation and Assessment Revisited

Direct Stimulatory Effects of the CB2 Ligand JTE 907 in Human and Mouse Islets

Contact Info

Product

Resources

About