2008
DOI: 10.1590/s0100-204x2008000500014
|View full text |Cite
|
Sign up to set email alerts
|

Alternative genotyping method for the single nucleotide polymorphism A2959G (AF159246) of the bovine CAST gene

Abstract: The objective of this work was to genotype the single nucleotide polymorphism (SNP) A2959G (AF159246) of bovine CAST gene by PCR-RFLP technique, and to report its use for the first time. For this, 147 Bos indicus and Bos taurus x Bos indicus animals were genotyped. The accuracy of the method was confirmed through the direct sequencing of PCR products of nine individuals. The lowest frequency of the meat tenderness favorable allele (A) in Bos indicus was confirmed. The use of PCR-RFLP for the genotyping of the … Show more

Help me understand this report

Search citation statements

Order By: Relevance

Paper Sections

Select...
1
1
1
1

Citation Types

0
4
0
2

Year Published

2009
2009
2023
2023

Publication Types

Select...
5
1

Relationship

1
5

Authors

Journals

citations
Cited by 7 publications
(6 citation statements)
references
References 5 publications
0
4
0
2
Order By: Relevance
“…The weak linkage disequilibrium hypothesis showed that other polymorphisms described in the CAST gene were closely related to variation in meat tenderness, namely the SNP A2959G (access number AF159246), at region 3' UTR, and G/C (nucleotide 282 of access number AY008267), at intron 5, identifi ed by Barendse (2004) and Schenkel et al (2006) respectively. Curi et al (2008) reported the genotyping of A2959G (AF159246) SNP of bovine CAST gene by PCR-RFLP technique for the fi rst time. The accuracy of the method was confi rmed through the direct sequencing of PCR products of nine individuals.…”
Section: Resultsmentioning
confidence: 99%
“…The weak linkage disequilibrium hypothesis showed that other polymorphisms described in the CAST gene were closely related to variation in meat tenderness, namely the SNP A2959G (access number AF159246), at region 3' UTR, and G/C (nucleotide 282 of access number AY008267), at intron 5, identifi ed by Barendse (2004) and Schenkel et al (2006) respectively. Curi et al (2008) reported the genotyping of A2959G (AF159246) SNP of bovine CAST gene by PCR-RFLP technique for the fi rst time. The accuracy of the method was confi rmed through the direct sequencing of PCR products of nine individuals.…”
Section: Resultsmentioning
confidence: 99%
“…The CAST/DdeI polymorphism involved the amplification of a 486 bp fragment in the 3´UTR using forward 5'TGAATTTGTCTGGTTCACCTGT3' and reverse primer 5'GACAAGGTGCGGAAGTCCTA3', described in this work for the first time, and was followed by DdeI restriction endonuclease (Curi et al, 2008). The DdeI endonuclease recognizes the 5'C´TNAG 3' site restriction (Invitrogen, USA).…”
Section: Methodsmentioning
confidence: 99%
“…Barendse (2002) identified a single nucleotide polymorphism (SNP) characterized by the transition of an adenine to a guanine in the 3'UTR of the CAST gene (AF159246:g.2959A>G). The PCR-RFLP (Polymerase Chain Reaction-Restriction Fragment Length Polymorphism) methodology described by Curi et al (2008) to genotype this SNP and amplifies a 269 base pair (bp) fragment that, once digested by the restriction enzyme DdeI, yields either one 269 bp fragment in the case of the G allele or two fragments in the case of the A allele (137 and 132 bp). However, since only one restriction site for DdeI is found on this fragment, in cases of suboptimal enzyme performance, an undigested 269 bp fragment may be erroneously interpreted as an individual that presents homozygous genotype GG.…”
Section: Introductionmentioning
confidence: 99%
“…Este polimorfismo tem sido utilizado em técnicas de genotipagem utilizando espectrometria de massa e de associações significativas com as características relacionadas à qualidade da carne de bovinos de corte (CASAS et al, 2006;MORRIS et al, 2006). Além disso, o mesmo já foi descrito em técnicas de PCR-RFLP através da análise do mapa de restrição da sequência, uma vez que está localizado no sítio de reconhecimento da enzima Dde I (CURI et al, 2008). A predominância do alelo A em CAST_2959 foi relatada por Curi et al (2009) e Ribeca et al (2012).…”
Section: Calpastatinaunclassified