Indexação biológica múltipla e RT-PCR para detecção de vírus latentes em macieiras

Characterization and genetic variability of coat protein genes of Apple chlorotic leaf spot virus isolates from southern Brazil

“…Phylogenetic analysis of the nineteen ACLSV sequences [18 ACLSV isolates from this study and one isolate (BR1) from a previous report (Silva et al 2008)] and representative foreign isolates revealed their clustering into two groups based on nucleotide sequences (Fig. 3); daa sequence analysis Fig.…”

“…First strand cDNA synthesis reactions were carried out with Moloney murine leukemia virus reverse transcriptase (Invitrogen, 200 U/μl), using an oligo-dT primer or reverse primer CL7365r (5′CTAAATGCAAAGAT CAGTCGAC 3′). PCR thermocycling (PTC100, MJ Research Inc.) was carried out under conditions described previously (Silva et al 2008), using primers CL7365r and CL6784s (5′ ATGGCAGCAGTTCTGAATTTG 3′).…”

Serological and Molecular Detection of Latent Viruses in the Apple Germplasm Bank of Santa Catarina

“…Therefore, rootstocks of unknown sanitary conditions probably are the main factor associated with high rates of infection. Latent virus infection would lead to plant decline and death, depending on virus strain and cultivar susceptibility, primarily as observed in apples grafted on 'Marubakaido', the most common apple rootstock in Brazil associated with ASGV and ACLSV [2,10]. Occurrence of ASGV, ASPV and ACLSV in accessions of AGB-Epagri would not recommend them for germoplasm exchange.…”

“…Multiple virus infections result in death, plant predisposition to other pathogens, sharp drop in production, and low quality of fruits [2,3,4,5]. Less aggressive infections of latent viruses probably interfere in phenotype HIGHLIGHTS  RT-PCR, DAS-ELISA and IC-RT-PCR reveals ASGV, ASPV and ACLS latent mixed infection in accessions of the Apple Germplasm Bank of Epagri.…”

Simultaneous detection of four viruses affecting apple and pear by molecular hybridization using a polyprobe

“…The complete coat protein gene of these four Brazilian viral isolates have been previously molecularly characterized: ASGV, UV01 isolate (NICKEL et al, 2001), ACLSV, BR1 isolate (SILVA et al, 2008), ASPV, br1 isolate (RADAELLI et al, 2006) and ApMV, M003 isolate (FAJARDO et al, 2011) in studies developed in the Virology Laboratory at Embrapa Grape & Wine, Bento Gonçalves-RS, Brazil.…”