HFE gene mutations in coronary atherothrombotic disease

Abstract

Although iron can catalyze the production of free radicals involved in LDL lipid peroxidation, the contribution of iron overload to atherosclerosis remains controversial. The description of two mutations in the HFE gene (Cys282Tyr and His63Asp) related to hereditary hemochromatosis provides an opportunity to address the question of the association between iron overload and atherosclerosis. We investigated the prevalence of HFE mutations in 160 survivors of myocardial infarction with angiographically demonstrated severe coronary atherosclerotic disease, and in 160 age-, gender-and race-matched healthy control subjects. PCR amplification of genomic DNA followed by RsaI and BclI restriction enzyme digestion was used to determine the genotypes. The frequency of the mutant Cys282Tyr allele was identical among patients and controls (0.022; carrier frequency, 4.4%), whereas the mutant His63Asp allele had a frequency of 0.143 (carrier frequency, 27.5%) in controls and of 0.134 (carrier frequency, 24.5%) in patients. Compound heterozygotes were found in 2 of 160 (1.2%) controls and in 1 of 160 (0.6%) patients. The finding of a similar prevalence of Cys282Tyr and His63Asp mutations in the HFE gene among controls and patients with coronary atherothrombotic disease, indirectly questions the possibility of an association between hereditary hemochromatosis and atherosclerosis.

Prevalence of C282Y and H63D mutations in the HFE gene of Brazilian individuals with clinical suspicion of hereditary hemochromatosis

“…The frequencies of C282Y and H63D mutations found in this study are greater than those reported for the general Brazilian population, 1,8,11,13,15,[17][18][19][20][21][22] but are smaller than the genotypic frequencies among patients with HH. 2,3,4 It is unquestionable that C282Y is the main mutation responsible for HH in all studied populations, as the majority of published reports worldwide cite its prevalence in more than 80% of individuals with clinical manifestations of HH, 1,[4][5][6]12,15,17,23 thus several other diagnostic guides are based on the result of C282Y mutation genic testing.…”

“…3 In the present study, the allele frequency of H63D was 0.196 and in accordance with the majority of the other world populations, in which the frequency ranges from 0.1 to 0.2; it is important to note that Spain and Portugal, countries that greatly influenced colonization of Brazil, present frequencies greater than 0.2 in their general populations. 4,11 The frequency of 0.03 for C282Y/H63D compound heterozygotes is in accordance with data already reported for the American population, 14 but it does not concur with Brazilian data, 1,11,15,21,22 probably because of the quantitative difference of the studied populations and because of the fact that this paper assessed individuals with clinical suspicion of HH. Thus, this frequency values the role of the C282Y/ H63D genotype in the development of HH.…”

“…2,3,4 It is unquestionable that C282Y is the main mutation responsible for HH in all studied populations, as the majority of published reports worldwide cite its prevalence in more than 80% of individuals with clinical manifestations of HH, 1,[4][5][6]12,15,17,23 thus several other diagnostic guides are based on the result of C282Y mutation genic testing. 2,6,7,15 It is not different for the Brazilian population, as in the paper by Bittencourt et al, 1 homozygous individuals for this mutation present an earlier onset for pathological aspects compared to heterozygous individuals with an onset at an earlier age than the wild allele, 282CC. The allele frequency of 282Y in the present study was 7.9%; a rate considerably greater than other Brazilian studies (2% in general population), 11 indicating a relationship between this mutation and clinical suspicion of HH.…”

“…C282Y and H63D mutations were detected by the Polymerase Chain Reaction technique followed by enzymatic restriction (PCR-RFLP); utilizing specific oligonucleotides C282YR: 5' CTCAGGCACTCCTCTCAACC 3', C282YF: 5' TGG CAA GGGTAAACAGATCC 3', H63DR: 5' GCCACATC TGGCT TGAAATT 3' and H63DF: 5' ACATGGTTAAGGCC TGTTGC 3'.1 The PCR products for C282Y and H63D were digested, respectively, by the restriction endonucleases RsaI and BclI, specific for each site of mutations. 15 The denominations 282CC (63HH), 282CY (63HD) and 282YY (63DD) refer to the wild allele, and heterozygous and homozygous mutations of C282Y, respectively. Fragments of 247 and 140pb are encountered for the wild allele (282CC) and of 247, 111 and 29pb for the homozygous allele (282YY).…”

Estudo das mutações C282Y, H63D e S65C do gene HFE em doentes brasileiros com sobrecarga de ferro

“…9,16 Os estudos brasileiros publicados estimam que a prevalência da mutação C282Y é cerca de três a oito vezes menor comparada à observada nos indivíduos caucasianos do nordeste europeu, enquanto a freqüência das mutações H63D e S65C é semelhante entre estas populações. [17][18][19][20][21] Entretanto, não encontramos nenhum trabalho que tenha analisado os efeitos do genótipo HFE sobre o estado de ferro do organismo e a influência de fatores genéticos, clíni-cos ou ambientais nos doentes com mutação do gene HFE.…”