Detection and coat protein gene characterization of an isolate of Grapevine virus B from corky bark-affected grapevines in Southern Brazil

Abstract

An isolate of Grapevine virus B (GVB), obtained by indexing Vitis labrusca and V. vinifera grapevines on the indicator LN33, was transmitted mechanically to several Nicotiana species. The virus was partially purified from N. cavicola and the coat protein estimated at 23 kDa by SDS-PAGE. In negatively stained leaf extracts of experimentally inoculated N. cavicola and N. occidentalis, flexuous particles with cross banding were observed, predominantly measuring 750-770 x 12 nm, with a modal length of 760 nm. Decoration indicated a clear, positive reaction against AS-GVB. In DAS-ELISA, GVB was detected in N. cavicola and grapevine extracts, and Western blots showed homologous and cross reaction of GVB and GVA antisera with GVB coat protein. Using specific primers for GVB, a fragment of 594 bp, comprising the coat protein gene coding for 197 amino acids, was amplified by RT-PCR with viral RNA extracted from GVB-infected N. occidentalis. The nucleotide and the deduced amino acid sequences of the coat protein gene showed high identities with Italian and Japanese isolates of GVB.

Incidência de vírus em videiras no Nordeste brasileiro e caracterização molecular parcial de isolados virais locais

“…A identidade de aad entre todos os isolados de GVB analisados variou de 95,4% a 100% (Tabela 2). Variabilidade entre isolados de GVA e GVB já havia sido verificada (MOREIRA et al, 2004a;MOREIRA et al, 2004b;NICkEL et al, 2002;FAJARDO et al, 2003), entretanto, sem considerar isolados provenientes do Nordeste brasileiro, identificados posteriormente.…”

“…As condições das reações de RT-PCR em tempo real foram descritas previamente (DuBIELA et al, 2013) A caracterização molecular parcial foi desenvolvida por meio da análise da sequência de nucleotídeos de três importantes espécies virais (GVA, GVB e GLRaV-3), cujos isolados foram detectados no levantamento. Os oligonucleotídeos para a amplificação por RT-PCR convencional foram definidos com base em trabalhos anteriores ou definidos neste trabalho: GVA-v1 (F) (5'ATGGCACACTACGCCAAGAGGG3') e C1197 (R) para GVA (FAJARDO et al, 2003); GVB-6445 (F) e GVB-7038 (R) para GVB (NICkEL et al, 2002) e LR3-8504 (F) e LR3-9445 (R) para GLRaV-3 (FAJARDO et al, 2007). A síntese do cDNA e as reações de PCR foram conduzidas conforme metodologia descrita por FAJARDO et al (2003).…”

Production of polyclonal antisera using recombinant coat proteins of Grapevine leafroll-associated virus 2 and Grapevine virus B

“…Therefore, the CP gene variability should be considered, since some epitopes of the coat protein are the basis for antibody recognition by ELISA. It was demonstrated that GLRaV-2 and GVB Brazilian isolates show 94-98% and 82% nucleotide identities, respectively, with foreign isolates from different geographic origins (Nickel et al, 2002). Thus, it is reasonable to assume that antisera produced in this study could not recognize all foreign isolates or strains, and vice-versa, highlighting the importance of antisera production against local isolates.…”

“…Procedures were performed according to Sambrook & Russel (2001) The CP gene of GVB, isolate BR1, from grapevines indexed on the indicator LN33, collected in Rio Grande do Sul, Brazil, was amplifi ed by RT-PCR with the oligonucleotides GVB6445 (5'ATGGAAAATATATCCCGGATGG3', viral sense) and GVB7038 (5'ACTCGTCAGACAACTCTATA TC3', complementary sense) (Saldarelli et al, 1996), ligated into the pGEM-T Easy vector (Promega), cloned in E. coli JM109 cells and sequenced (GenBank access number AF438410) (Nickel et al, 2002).…”

“…The large number of nowadays available nucleotide sequences of GLRaV-2 (Meng et al, 2005) and GVB (Saldarelli et al, 1996;Nickel et al, 2002), associated with the last development of molecular biology techniques, have turned expressing viral genes into an extremely powerful strategy for the production of antibodies against plant viruses. Despite the development of nucleotide sequence-based detection methods, ELISA remains highly relevant for large scale identifi cation of grapevine virus (Fajardo et al, 2003).…”