Alternative genotyping method for the single nucleotide polymorphism A2959G (AF159246) of the bovine CAST gene

Curi, Rogério Abdallah; Chardulo, Luis Artur Loyola; Silveira, Antônio Carlos; Oliveira, Henrique Nunes de

doi:10.1590/s0100-204x2008000500014

Cited by 7 publications

(5 citation statements)

References 5 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The weak linkage disequilibrium hypothesis showed that other polymorphisms described in the CAST gene were closely related to variation in meat tenderness, namely the SNP A2959G (access number AF159246), at region 3' UTR, and G/C (nucleotide 282 of access number AY008267), at intron 5, identifi ed by Barendse (2004) and Schenkel et al (2006) respectively. Curi et al (2008) reported the genotyping of A2959G (AF159246) SNP of bovine CAST gene by PCR-RFLP technique for the fi rst time. The accuracy of the method was confi rmed through the direct sequencing of PCR products of nine individuals.…”

Section: Resultsmentioning

confidence: 99%

Genetic polymorphisms related to meat traits in purebred and crossbred Nelore cattle

Curi

Fortes

Chardulo

et al. 2009

Pesq. agropec. bras.

Self Cite

View full text Add to dashboard Cite

-The objective of this work was to estimate the allelic and genotypic frequencies of CAST/XmnI, a calpastatin gene polymorphism, and CAPN530, a calpain 1 large subunit gene polymorphism, in different beef genetic groups (Nelore and Nelore x Bos taurus), and to investigate associations between these polymorphisms and carcass and meat traits. Three hundred animals -comprising 114 Nelore, 67 Angus x Nelore, 44 Rubia Gallega x Nelore, 41 Canchim, 19 Brangus three-way cross and 15 Braunvieh three-way cross -were genotyped by PCR-RFLP and phenotyped for rib-eye area (REA), back-fat thickness (BT), intramuscular fat (IF), shear force (SF) and myofi brillar fragmentation index (MFI). The occurrence of the two alleles of the CAST/XmnI and CAPN530 single nucleotide polymorphisms (SNPs) in a B. indicus breed, which permitted association studies in purebred and crossbred Nelore cattle, was fi rst shown in the present work. No relationship was found between the CAST or CAPN1 SNPs and growth-related traits (REA) or fat deposition (BT and IF), since calpastatin and μ-calpain are not physiologically involved with these traits. Moreover, the association results between genotypes and aged meat tenderness (assessed by SF and MFI) showed that these markers are useless in assisted selection for purebred Nelore and their crosses with B. taurus.Index terms: Bos indicus, calpain gene, calpastatin gene, meat tenderness, single nucleotide polymorphisms. Polimorfi smos genéticos relacionados às características da carne em bovinos Nelore puros e cruzadosResumo -O presente trabalho objetivou estimar, em bovinos de corte de diferentes grupos genéticos (Nelore e Nelore x Bos taurus), as frequências alélicas e genotípicas dos polimorfi smos CAST/XmnI, do gene da calpastatina, e CAPN530, do gene da calpaína, bem como avaliar a ocorrência de associações entre esses polimorfi smos e características da carcaça e da carne produzida. Trezentos animais -114 Nelore, 67 Angus x Nelore, 44 Rubia Galega x Nelore, 41 Canchim, 19 tricross Brangus e 15 tricross Braunvieh -foram genotipados por PCR-RFLP e fenotipados para área de olho de lombo (AOL), cobertura de gordura subcutânea (CGS), gordura intramuscular (GI), força de cisalhamento (FC) e índice de fragmentação miofi brilar (IFM). A ocorrência dos dois alelos dos polimorfi smos de nucleotídeo único (SNPs) CAST/XmnI e CAPN530 em animais B. indicus, que viabilizou estudos de associação em gado Nelore puro e cruzado, foi demonstrada pela primeira vez neste trabalho. Nenhuma relação foi encontrada entre os SNPs dos genes CAST e CAPN1 e as características de crescimento (AOL) ou deposição de gordura (CGS e GI), já que a calpastatina e a μ-calpaína não estão fi siologicamente envolvidas com essas características. Os resultados de associação entre os genótipos e a maciez da carne maturada (avaliada por FC e IFM) mostraram a pouca utilidade desses marcadores na seleção de bovinos Nelore puros ou cruzados com B. taurus.Termos para indexação: Bos indicus, gene da calpaína, gene da calpastatina, maciez d...

show abstract

Section: Resultsmentioning

confidence: 99%

Genetic polymorphisms related to meat traits in purebred and crossbred Nelore cattle

Curi

Fortes

Chardulo

et al. 2009

Pesq. agropec. bras.

Self Cite

View full text Add to dashboard Cite

show abstract

“…The CAST/DdeI polymorphism involved the amplification of a 486 bp fragment in the 3´UTR using forward 5'TGAATTTGTCTGGTTCACCTGT3' and reverse primer 5'GACAAGGTGCGGAAGTCCTA3', described in this work for the first time, and was followed by DdeI restriction endonuclease (Curi et al, 2008). The DdeI endonuclease recognizes the 5'C´TNAG 3' site restriction (Invitrogen, USA).…”

Section: Methodsmentioning

confidence: 99%

“…Barendse (2002) identified a single nucleotide polymorphism (SNP) characterized by the transition of an adenine to a guanine in the 3'UTR of the CAST gene (AF159246:g.2959A>G). The PCR-RFLP (Polymerase Chain Reaction-Restriction Fragment Length Polymorphism) methodology described by Curi et al (2008) to genotype this SNP and amplifies a 269 base pair (bp) fragment that, once digested by the restriction enzyme DdeI, yields either one 269 bp fragment in the case of the G allele or two fragments in the case of the A allele (137 and 132 bp). However, since only one restriction site for DdeI is found on this fragment, in cases of suboptimal enzyme performance, an undigested 269 bp fragment may be erroneously interpreted as an individual that presents homozygous genotype GG.…”

Section: Introductionmentioning

confidence: 99%

Alternative methodologies for genotyping polymorphisms in the CAST and CAPN1 genes in beef cattle

et al. 2019

View full text Add to dashboard Cite

The objectives of this study were to genotype single nucleotide polymorphisms (SNP) AF159246:g.2959A>G (CAST/DdeI) and AF248054.2:g.6545C>T (CAPN4751) in beef cattle by PCR-RFLP (Polymerase Chain Reaction -Restriction Fragment Length Polymorphism), using the restriction enzyme DdeI for both SNP, and describe the use of these genotyping methodologies for the first time. For the SNP located in the CAST gene, new primers were designed, and for the SNP of the CAPN1 gene, the same primers previously described in the literature were used. Bonsmara, Caracu, Senepol, Nelore, and Angus bulls were chosen from among the most used bulls in breeding programs according to their genealogy and the lowest possible degree of parentage between them to ensure an experimental sample representative of the genetic variability in each breed. For the CAST and CAPN1 genes, respectively, the following number of animals were analyzed: Bonsmara (n = 25/22), Caracu (n = 25/26), Senepol (n = 25/24), Nelore (n = 26/26), and Angus (n = 25/24). The accuracy of these methodologies was confirmed by direct sequencing of PCR products generated for the two polymorphisms. The new primers developed for CAST/DdeI SNP detection and the use of DdeI enzyme for CAPN4751 SNP detection were effective in genotyping, since no inconclusive genotypes were observed for these genes. Thus, the genotyping of beef cattle using the PCR-RFLP technique for CAST and CAPN1 genes is robust, relatively inexpensive, and easy to perform in any basic molecular biology laboratory. If the association of these markers with traits of economic interest in beef cattle is confirmed in new studies, these methodologies may contribute to the selection of animals with superior genetics, i.e., with the potential to produce better-quality meat, either by marker-assisted selection or by the inclusion of these polymorphisms in high-density marker panels.

show abstract

“…Este polimorfismo tem sido utilizado em técnicas de genotipagem utilizando espectrometria de massa e de associações significativas com as características relacionadas à qualidade da carne de bovinos de corte (CASAS et al, 2006;MORRIS et al, 2006). Além disso, o mesmo já foi descrito em técnicas de PCR-RFLP através da análise do mapa de restrição da sequência, uma vez que está localizado no sítio de reconhecimento da enzima Dde I (CURI et al, 2008). A predominância do alelo A em CAST_2959 foi relatada por Curi et al (2009) e Ribeca et al (2012).…”

Section: Calpastatinaunclassified

Aplicação Da Genética Molecular Para a Melhoria Da Qualidade Da Carne Bovina

Kirinus

Fruet

Teixeira

et al. 2014

REGET

View full text Add to dashboard Cite

A bovinocultura de corte representa grande importância econômica no contexto mundial e nacional. Os objetivos deste trabalho é revisar alguns aspectos relevantes da aplicação da genética molecular para a melhoria da qualidade da carne bovina com vistas à definição de qualidade do produto cárneo e de mercados consumidores mais exigentes. Tendo em vista a necessidade do mercado consumidor em avaliar a carne produzida, faz-se necessário conhecer as características econômicas do produto a ser consumido, assim como padronizar e implementar técnicas mais sofisticadas para a avaliação das propriedades reológicas da carne. Neste contexto, devido aos inúmeros processos bioquímicos no qual estão envolvidos os sistemas de ativação de enzimas proteolíticas e a degradação das proteínas miofibrilares, os métodos moleculares vêm sendo utilizados como ferramenta para a avalição genética dos fatores que influenciam a maciez da carne bovina.

show abstract

Alternative genotyping method for the single nucleotide polymorphism A2959G (AF159246) of the bovine CAST gene

Cited by 7 publications

References 5 publications

Genetic polymorphisms related to meat traits in purebred and crossbred Nelore cattle

Genetic polymorphisms related to meat traits in purebred and crossbred Nelore cattle

Alternative methodologies for genotyping polymorphisms in the CAST and CAPN1 genes in beef cattle

Aplicação Da Genética Molecular Para a Melhoria Da Qualidade Da Carne Bovina

Contact Info

Product

Resources

About