In vivo electroporation works as an effective method to transfer exogenous genes into postnatal rodent forebrain. Nevertheless, two deficiencies were found in the reported methods. First, surgical operation brings unnecessary trauma to newborn pups. Second, the procedure was complicated and the transfection efficiency was relatively low. Here we improved the previous electroporation method and make it more simple and efficient. The pulse voltage was decreased to 90 v. DNA injection into one pup's forebrain could be completed within 30 s without any surgical operation. More than 94% of injected neonates survived. Almost 100% of the survivors expressed the introduced gene and the expression persists as long as 20 days after injection. Thus, this method offers a powerful new way for gene function study in postnatal neurogenesis and neural development.
Cpne5 belongs to Copine (Cpne) family, all of which are Ca 2+dependent, phospholipid-binding proteins that are highly conserved in animals. There are eight homologous Copine genes in mammalians. Cpne5 contains two C2 domains at N-terminus and an A-domain at C-terminus, which were conserved in other Cpne members [1]. The C2 domain is responsible for mediating Ca 2+dependent cellular processes. The A-domain at the C-terminus is similar to the extracellular "A-domain" of integrins, which is responsible for protein-protein interaction usually in Ca 2+ -, Mg 2+ -, and/or Mn 2+ -dependent manner [2]. Highly conserved molecular structure indicates the pivotal role of Cpne5 in mammalian. Our previous work demonstrated that Cpne5 was highly expressed in embryonic mouse brain. The distribution of Cpne5 in embryonic rodent brain indicated its essential role in the central nervous system (CNS) [3]. However, the exact role of Cpne5 in CNS remains unclear.To investigate the role of Cpne5 in CNS, we generated Cpne5 knockout mouse model. Our strategy is to replace the first exon of Cpne5 and about 2.6 kb of upstream sequence (containing start code) of Cpne5 genome with a PGK-neo cassette based on the homologous recombination (as shown in Figure 1A). After constructing the Cpne5 targeting vector, the targeting vector was linearized at 5 0 -end by NotI [4,5]. The product was purified and delivered into embryonic stem cells (ES cells, R1, 129/SvJ X 129/ Sv-CP) using electroporation. G418 and ganciclovir were used to primarily screen the positive ES clone. PCR analysis was used to confirm the positive clone. The targeting vector was used as a positive control (PC), and 129svJ genomic DNA was used as a negative control (NC). Southern blot was used to further confirm the positive clone. Next, one of the confirmed positive clones was injected into C57BL/6 blastulas, which were subsequently transferred into pseudopregnant females to generate chimeric offspring. Next, the highly chimeric offsprings were bred with 129/ svJ female mice to produce heterozygotes. PCR analysis was used to identify heterozygotes [6]. Specific oligonucleotide primers were used for the Cpne5 targeted allele (Forward:5 0 GCATCGC ATTGTCTGAGTAGGTG3 0 and Reverse: 5 0 GCCAGTCCCTCTCAA TTCTCCT3 0 , product length: 519 bp).For the wild-type allele, Forward:5 0 ATGGCGTCGCTCA GCGAGTT 3 0 and Reverse: 5 0 TGGGACCCCTGTTTCCGTGT 3 0 , product length: 351 bp. Immunostaining was used to characterize the homozygotes. After breeding with C57/BL6J over eight generations, homozygotes were generated and the 129/SvJ background was successfully removed.To investigate the role of Cpne5, 11 female homozygotes and seven female wild-type mice from littermate were used to perform behavioral test, including open field (OF), Y-maze, novelty recognition (NR), light-dark box (LDB), elevated plus maze (EPM), and elevated platform (EP) task [7]. The entire behavioral tasks were performed as described previously with minor modifications [8][9][10]. Briefly, in OF task, mouse was placed at the ce...
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
customersupport@researchsolutions.com
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.