Cpne5 is Involved in Regulating Rodent Anxiety Level

Abstract

Cpne5 belongs to Copine (Cpne) family, all of which are Ca 2+dependent, phospholipid-binding proteins that are highly conserved in animals. There are eight homologous Copine genes in mammalians. Cpne5 contains two C2 domains at N-terminus and an A-domain at C-terminus, which were conserved in other Cpne members [1]. The C2 domain is responsible for mediating Ca 2+dependent cellular processes. The A-domain at the C-terminus is similar to the extracellular "A-domain" of integrins, which is responsible for protein-protein interaction usually in Ca 2+ -, Mg 2+ -, and/or Mn 2+ -dependent manner [2]. Highly conserved molecular structure indicates the pivotal role of Cpne5 in mammalian. Our previous work demonstrated that Cpne5 was highly expressed in embryonic mouse brain. The distribution of Cpne5 in embryonic rodent brain indicated its essential role in the central nervous system (CNS) [3]. However, the exact role of Cpne5 in CNS remains unclear.To investigate the role of Cpne5 in CNS, we generated Cpne5 knockout mouse model. Our strategy is to replace the first exon of Cpne5 and about 2.6 kb of upstream sequence (containing start code) of Cpne5 genome with a PGK-neo cassette based on the homologous recombination (as shown in Figure 1A). After constructing the Cpne5 targeting vector, the targeting vector was linearized at 5 0 -end by NotI [4,5]. The product was purified and delivered into embryonic stem cells (ES cells, R1, 129/SvJ X 129/ Sv-CP) using electroporation. G418 and ganciclovir were used to primarily screen the positive ES clone. PCR analysis was used to confirm the positive clone. The targeting vector was used as a positive control (PC), and 129svJ genomic DNA was used as a negative control (NC). Southern blot was used to further confirm the positive clone. Next, one of the confirmed positive clones was injected into C57BL/6 blastulas, which were subsequently transferred into pseudopregnant females to generate chimeric offspring. Next, the highly chimeric offsprings were bred with 129/ svJ female mice to produce heterozygotes. PCR analysis was used to identify heterozygotes [6]. Specific oligonucleotide primers were used for the Cpne5 targeted allele (Forward:5 0 GCATCGC ATTGTCTGAGTAGGTG3 0 and Reverse: 5 0 GCCAGTCCCTCTCAA TTCTCCT3 0 , product length: 519 bp).For the wild-type allele, Forward:5 0 ATGGCGTCGCTCA GCGAGTT 3 0 and Reverse: 5 0 TGGGACCCCTGTTTCCGTGT 3 0 , product length: 351 bp. Immunostaining was used to characterize the homozygotes. After breeding with C57/BL6J over eight generations, homozygotes were generated and the 129/SvJ background was successfully removed.To investigate the role of Cpne5, 11 female homozygotes and seven female wild-type mice from littermate were used to perform behavioral test, including open field (OF), Y-maze, novelty recognition (NR), light-dark box (LDB), elevated plus maze (EPM), and elevated platform (EP) task [7]. The entire behavioral tasks were performed as described previously with minor modifications [8][9][10]. Briefly, in OF task, mouse was placed at the ce...

Combining genome-wide association study and transcriptome analysis to identify molecular markers and genetic basis of population-asynchronous ovarian development in <i>Coilia nasus</i>

“…The cpne5 gene (orthologous to cpne5a ) belongs to the copine gene family and encodes C2 structural domain-containing, Ca 2+ -dependent, phospholipid-binding proteins, which guide ligands through biofilms according to the binding characteristics of ligands to phospholipids ( Damer et al, 2007 ). This gene is also reported to play a crucial role in the central nervous system ( Ding et al, 2008 , 2017 ), and is associated with alcohol dependence and obesity in Caucasians ( Wang et al, 2015 ). Although there is no current research demonstrating the direct function of cpne5a in ovarian development, recent GWAS analysis of pre- and post-pubertal heifers detected a significant correlation between the cpne5 gene and phenotypic traits, with RNA-seq analysis showing differential expression of cpne5 in the endometrium ( Cánovas et al, 2014 ).…”

The role of circadian rhythm in the regulation of cellular protein profiles in the brain

“…[37]. In a study using a CPNE5 knockout mice, CPNE5 deficiency reduce the anxiety level in rodents [38]. Mitochondrial MAON is encoded by human ME3 gene, is a pivotal member of malic enzyme family.…”

Copines, a Family of Calcium Sensor Proteins and Their Role in Brain Function

“…Overall, these findings point to the multifaceted involvement of Copine 5 in brain development. In a subsequent study, the same group also generated a constitutive knockout mouse line by deleting the 5′-upstream sequence and exon 1 in the Copine 5 gene [ 82 ]. The mice were viable and had no gross abnormalities in overall anatomy.…”