Purpose It is an open question whether cell transplantation can provide safety and effective outcome to spinal cord injury (SCI) patient which has remained controversial for almost 40 years. This study aimed to evaluate the safety and efficacy of cell transplantation in SCI patients. Method Studies of the cell transplantation for SCI were retrieved from PubMed, Embase, Medline, Cochrane Library and analyzed quantitative data by Review Manager 5.3.Results Twenty-one clinical controlled studies with 973 patients were included. The pooled results suggested that cell transplantation significantly improved ASIA score, ASIA motor score, ASIA sensory score, Barthel Index score, residual urine volume, rehabilitative time of automatic micturition. Furthermore, subgroup analysis indicated that the stem cells exhibited more potent than the non-stem cells in spinal cord repair. Cell transplantation at more than 14 days after injury showed more significant improvements than that within 14 days from injury. The dosage of cell transplantation between 1-5 × 10 7 and 10-20 × 10 7 was the potent quantity for the patient with SCI. Intrathecal injection and intravenous + intrathecal injection showed more superior to the other method. The top 5 adverse events were febrile reaction (11.5%), neurologic pain (11.3%), headache (2.6%), neurologic deterioration (2.4%), and rigidity or spasticity (1.6%). Conclusion Cell transplantation appears to be a safe therapeutic strategy possessing substantial beneficial effects in the patients with SCI in clinic. Moreover, treating SCI with stem cell, the dosage of cells between 1-5 × 10 7 and 10-20 × 10 7 , in intermediate or chronic phase, minimally invasive techniques, may bring more advantage to SCI patient.
Aims Whether to perform hybrid surgery (HS) in contrast to anterior cervical discectomy and fusion (ACDF) when treating patients with multilevel cervical disc degeneration remains a controversial subject. To resolve this we have undertaken a meta-analysis comparing the outcomes from HS with ACDF in this condition. Methods Seven databases were searched for studies of HS and ACDF from inception of the study to 1 September 2019. Both random-effects and fixed-effects models were used to evaluate the overall effect of the C2-C7 range of motion (ROM), ROM of superior/inferior adjacent levels, adjacent segment degeneration (ASD), heterotopic ossification (HO), complications, neck disability index (NDI) score, visual analogue scale (VAS) score, Japanese Orthopaedic Association (JOA) score, Odom’s criteria, blood loss, and operating and hospitalization time. To obtain more credible results contour-enhanced funnel plots, Egger’s and Begg’s tests, meta-regression, and sensitivity analyses were performed. Results In total, 17 studies involving 861 patients were included in the analysis. HS was found to be superior to ACDF in maintaining C2-C7 ROM and ROM of superior/inferior adjacent levels, but HS did not reduce the incidence of associated level ASD. Also, HS did not cause a higher rate of HO than ACDF. The frequency of complications was similar between the two techniques. HS failed to achieve more favourable outcomes than ACDF using the NDI, VAS, JOA, and Odom’s scores. HS did not show any more advantages in operating or hospitalization time but did show reduction in blood loss. Conclusion Although HS maintained cervical kinetics, it failed to reduce the incidence of ASD. This finding differs from previous reports. Moreover, patients did not show more benefits from HS with respect to symptom improvement, prevention of complications, and clinical outcomes. Cite this article: Bone Joint J 2020;102-B(8):981–996.
Cpne5 belongs to Copine (Cpne) family, all of which are Ca 2+dependent, phospholipid-binding proteins that are highly conserved in animals. There are eight homologous Copine genes in mammalians. Cpne5 contains two C2 domains at N-terminus and an A-domain at C-terminus, which were conserved in other Cpne members [1]. The C2 domain is responsible for mediating Ca 2+dependent cellular processes. The A-domain at the C-terminus is similar to the extracellular "A-domain" of integrins, which is responsible for protein-protein interaction usually in Ca 2+ -, Mg 2+ -, and/or Mn 2+ -dependent manner [2]. Highly conserved molecular structure indicates the pivotal role of Cpne5 in mammalian. Our previous work demonstrated that Cpne5 was highly expressed in embryonic mouse brain. The distribution of Cpne5 in embryonic rodent brain indicated its essential role in the central nervous system (CNS) [3]. However, the exact role of Cpne5 in CNS remains unclear.To investigate the role of Cpne5 in CNS, we generated Cpne5 knockout mouse model. Our strategy is to replace the first exon of Cpne5 and about 2.6 kb of upstream sequence (containing start code) of Cpne5 genome with a PGK-neo cassette based on the homologous recombination (as shown in Figure 1A). After constructing the Cpne5 targeting vector, the targeting vector was linearized at 5 0 -end by NotI [4,5]. The product was purified and delivered into embryonic stem cells (ES cells, R1, 129/SvJ X 129/ Sv-CP) using electroporation. G418 and ganciclovir were used to primarily screen the positive ES clone. PCR analysis was used to confirm the positive clone. The targeting vector was used as a positive control (PC), and 129svJ genomic DNA was used as a negative control (NC). Southern blot was used to further confirm the positive clone. Next, one of the confirmed positive clones was injected into C57BL/6 blastulas, which were subsequently transferred into pseudopregnant females to generate chimeric offspring. Next, the highly chimeric offsprings were bred with 129/ svJ female mice to produce heterozygotes. PCR analysis was used to identify heterozygotes [6]. Specific oligonucleotide primers were used for the Cpne5 targeted allele (Forward:5 0 GCATCGC ATTGTCTGAGTAGGTG3 0 and Reverse: 5 0 GCCAGTCCCTCTCAA TTCTCCT3 0 , product length: 519 bp).For the wild-type allele, Forward:5 0 ATGGCGTCGCTCA GCGAGTT 3 0 and Reverse: 5 0 TGGGACCCCTGTTTCCGTGT 3 0 , product length: 351 bp. Immunostaining was used to characterize the homozygotes. After breeding with C57/BL6J over eight generations, homozygotes were generated and the 129/SvJ background was successfully removed.To investigate the role of Cpne5, 11 female homozygotes and seven female wild-type mice from littermate were used to perform behavioral test, including open field (OF), Y-maze, novelty recognition (NR), light-dark box (LDB), elevated plus maze (EPM), and elevated platform (EP) task [7]. The entire behavioral tasks were performed as described previously with minor modifications [8][9][10]. Briefly, in OF task, mouse was placed at the ce...
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
customersupport@researchsolutions.com
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.