Parkinson's disease (PD) is a neurodegenerative disorder that is pathologically characterized by the presence of intracytoplasmic Lewy bodies, the major component of which are filaments consisting of ␣-synuclein. Two recently identified point mutations in ␣-synuclein are the only known genetic causes of PD, but their pathogenic mechanism is not understood.Here we show that both wild type and mutant ␣-synuclein form insoluble fibrillar aggregates with antiparallel ␤-sheet structure upon incubation at physiological temperature in vitro. Importantly, aggregate formation is accelerated by both PD-linked mutations. Under the experimental conditions, the lag time for the formation of precipitable aggregates is about 280 h for the wild type protein, 180 h for the A30P mutant, and only 100 h for the A53T mutant protein. These data suggest that the formation of ␣-synuclein aggregates could be a critical step in PD pathogenesis, which is accelerated by the PD-linked mutations.Parkinson's disease is a neurodegenerative disorder that predominantly affects dopaminergic neurons in the nigrostriatal system but also several other regions of the brain. Two dominant mutations, A53T and A30P, in ␣-synuclein cause familial early onset PD (1, 2). The function of ␣-synuclein and the pathogenic mechanism of these mutations is unknown, but ␣-synuclein has been detected in Lewy bodies (3-5) and shown to be their major filamentous component (6). Lewy bodies are a pathological hallmark of PD (7-9), and we therefore hypothesized that the PD mutations would cause or enhance ␣-synuclein aggregation. Indeed, a very recent publication demonstrated in vitro fibrillization of A53T mutant but not A30P mutant or wild type ␣-synuclein (10). Here we demonstrate aggregation of all forms of ␣-synuclein. In a complete aggregation time course, we show that there is an aggregation continuum; although all forms of ␣-synuclein do aggregate, aggregation is accelerated for both mutants; A30P aggregates slightly faster than wild type, and A53T aggregates much faster. Because both mutant forms enhance the aggregation tendency observed in the wild type, we hypothesize that aggregation of ␣-synuclein may be important in all forms of PD. EXPERIMENTAL PROCEDURESCloning, Bacterial Expression, and Purification of ␣-Synuclein-A 536-bp human ␣-synuclein cDNA was obtained by polymerase chain reaction amplification from an adult human brain cDNA library using primers corresponding to nucleotides 20 -42 and 532-556 of the published sequence (11). Polymerase chain reaction-based site-directed mutagenesis of this sequence was used to generate the mutant forms A53T/ A30P, and A53T ϩ A30P. For bacterial expression, all 4 forms were amplified using the primers TGTGGTCTAGAAGGAGGAATAACATA-TGGATGTATTCATGAAAGGTCTGTCAAAGGCCAAGGAGGGTGTT-GTG and GGGACCGCGGCTCGAGATTAGGCTTCAGGTTCGTAGTC-TTGATAACCTTCCTCA to alter 3 codons near the 5Ј end and 1 codon near the 3Ј end to more highly utilized Escherichia coli codons. The resulting PCR products were digested with NdeI and XhoI and cloned int...

Parkinson's disease (PD) is a neurodegenerative disorder that is pathologically characterized by the presence of intracytoplasmic Lewy bodies. Recently, two point mutations in ␣-synuclein were found to be associated with familial PD, but as of yet no mutations have been described in the homologous genes ␤-and ␥-synuclein. ␣-Synuclein forms the major fibrillar component of Lewy bodies, but these do not stain for ␤-or ␥-synuclein. This result is very surprising, given the extent of sequence conservation and the high similarity in expression and subcellular localization, in particular between ␣-and ␤-synuclein. Here we compare in vitro fibrillogenesis of all three purified synucleins. We show that fresh solutions of ␣-, ␤-, and ␥-synuclein show the same natively unfolded structure. While over time ␣-synuclein forms the previously described fibrils, no fibrils could be detected for ␤-and ␥-synuclein under the same conditions. Most importantly, ␤-and ␥-synuclein could not be cross-seeded with ␣-synuclein fibrils. However, under conditions that drastically accelerate aggregation, ␥-synuclein can form fibrils with a lag phase roughly three times longer than ␣-synuclein. These results indicate that ␤-and ␥-synuclein are intrinsically less fibrillogenic than ␣-synuclein and cannot form mixed fibrils with ␣-synuclein, which may explain why they do not appear in the pathological hallmarks of PD, although they are closely related to ␣-synuclein and are also abundant in brain. Parkinson's disease (PD)1 is a neurodegenerative disorder that predominantly affects dopaminergic neurons in the nigrostriatal system but also affects several other regions of the brain. Pathological hallmarks of PD are Lewy bodies and Lewy neurites (1-3), which also accumulate in dementia with Lewy bodies (4) but not in a variety of other neurodegenerative disorders. Recently, two dominant mutations in ␣-synuclein have been linked to familial early onset PD (5, 6). This has put ␣-synuclein at the center of investigations into the pathogenesis of PD.␣-Synuclein is closely related to two other proteins, ␤-and ␥-synuclein (Fig. 1A). With 78% similarity ␤-synuclein has been called an "almost carbon copy" of ␣-synuclein (7), and it was not trivial to generate antibodies that clearly distinguish both forms (8); ␥-synuclein shares 60% similarity at the amino acid level with ␣-synuclein (Fig. 1A). All three synucleins are highly expressed in the human brain and show a strikingly similar regional distribution. They are all expressed in the thalamus, substantia nigra, caudate nucleus, amygdala, and the hippocampus (9). Moreover, ␣-and ␤-synuclein even share the same subcellular distribution; they colocalize to presynaptic terminals in primary hippocampal neurons (10), and they show a virtually complete overlap in human and mouse brain sections as demonstrated by double-stained confocal microscopy (11). No ␣-or ␤-synuclein-specific synapses were identified (11). The high expression of ␤-and ␥-synuclein in the substantia nigra and their similarity to ␣-synuclein ...

The subvisible and visible particles present in a solution are often classified based on size, and are quantified by the actual number of particles present rather than by weight or molar amounts. The analysis of these particles in protein therapeutics are governed by compendial methods and the regulatory agencies, and the methods available to measure them originally evolved focusing on potential safety issues, including capillary occlusion and immunogenicity, that might arise from their presence. Ultracentrifugation, size exclusion chromatography, etc., discussed in previous articles, can be used to analyze aggregates of less than 0.10 microns. This article will focus on methods for analyzing and quantitating sub visible particles (SbVP) of 2 microns or larger. At the present time there is no routine method for quantitating sub visible particles (SbVP) between 0.1 microns and 2 microns. The most common technique for quantitating the amount of subvisible particles between 2 and 100 microns is the light obscuration method. This technique can determine size and amount of particles, but cannot differentiate between the types of particles, such as protein particles, foreign material, micro bubbles or silicone oil droplets, that can be present in protein solutions. The difficulties in adapting this method, originally developed for small molecule drugs for IV administration, to protein therapeutics delivered subcutaneously is discussed. The flow imaging techniques can determine morphology and optical characteristics of the particles, but still not identify the chemical composition. Other methods that can also be used, but are applicable for characterization purposes only, are discussed. The primary method for quantitating visible particles is visual inspection, a method that can be subjective and relies on adequate training of the human inspectors. Automated methods for visible particle determination are being developed. Identification of the chemical composition of isolated particles greater than about 50 microns is possible using several micro-spectroscopic methods, and these will also be discussed.

No abstract

No abstract

No abstract

Abstract. We calibrated the Multiple Element Limitation (MEL) model to Alaskan arctic tundra to simulate recovery of thermal erosion features (TEFs) caused by permafrost thaw and mass wasting. TEFs could significantly alter regional carbon (C) and nutrient budgets because permafrost soils contain large stocks of soil organic matter (SOM) and TEFs are expected to become more frequent as the climate warms. We simulated recovery following TEF stabilization and did not address initial, short-term losses of C and nutrients during TEF formation. To capture the variability among and within TEFs, we modeled a range of post-stabilization conditions by varying the initial size of SOM stocks and nutrient supply rates. Simulations indicate that nitrogen (N) losses after the TEF stabilizes are small, but phosphorus (P) losses continue. Vegetation biomass recovered 90% of its undisturbed C, N, and P stocks in 100 years using nutrients mineralized from SOM. Because of low litter inputs but continued decomposition, younger SOM continued to be lost for 10 years after the TEF began to recover, but recovered to about 84% of its undisturbed amount in 100 years. The older recalcitrant SOM in mineral soil continued to be lost throughout the 100-year simulation. Simulations suggest that biomass recovery depended on the amount of SOM remaining after disturbance. Recovery was initially limited by the photosynthetic capacity of vegetation but became co-limited by N and P once a plant canopy developed. Biomass and SOM recovery was enhanced by increasing nutrient supplies, but the magnitude, source, and controls on these supplies are poorly understood. Faster mineralization of nutrients from SOM (e.g., by warming) enhanced vegetation recovery but delayed recovery of SOM. Taken together, these results suggest that although vegetation and surface SOM on TEFs recovered quickly (25 and 100 years, respectively), the recovery of deep, mineral soil SOM took centuries and represented a major ecosystem C loss.

Fire frequency has dramatically increased in the tundra of northern Alaska, USA, which has major implications for the carbon budget of the region and the functioning of these ecosystems, which support important wildlife species. We investigated the postfire succession of plant and soil carbon (C), nitrogen (N), and phosphorus (P) fluxes and stocks along a burn severity gradient in the 2007 Anaktuvuk River fire scar in northern Alaska. Modeling results indicated that the early regrowth of postfire tundra vegetation was limited primarily by its canopy photosynthetic potential, rather than nutrient availability, because of the initially low leaf area and relatively high inorganic N and P concentrations in soil. Our simulations indicated that the postfire recovery of tundra vegetation was sustained predominantly by the uptake of residual inorganic N (i.e., in the remaining ash), and the redistribution of N and P from soil organic matter to vegetation. Although residual nutrients in ash were higher in the severe burn than the moderate burn, the moderate burn recovered faster because of the higher remaining biomass and consequent photosynthetic potential. Residual nutrients in ash allowed both burn sites to recover and exceed the unburned site in both aboveground biomass and production five years after the fire. The investigation of interactions among postfire C, N, and P cycles has contributed to a mechanistic understanding of the response of tundra ecosystems to fire disturbance. Our study provided insight on how the trajectory of recovery of tundra from wildfire is regulated during early succession.