Parkinson's disease (PD) is a neurodegenerative disorder that is pathologically characterized by the presence of intracytoplasmic Lewy bodies, the major component of which are filaments consisting of ␣-synuclein. Two recently identified point mutations in ␣-synuclein are the only known genetic causes of PD, but their pathogenic mechanism is not understood.Here we show that both wild type and mutant ␣-synuclein form insoluble fibrillar aggregates with antiparallel ␤-sheet structure upon incubation at physiological temperature in vitro. Importantly, aggregate formation is accelerated by both PD-linked mutations. Under the experimental conditions, the lag time for the formation of precipitable aggregates is about 280 h for the wild type protein, 180 h for the A30P mutant, and only 100 h for the A53T mutant protein. These data suggest that the formation of ␣-synuclein aggregates could be a critical step in PD pathogenesis, which is accelerated by the PD-linked mutations.Parkinson's disease is a neurodegenerative disorder that predominantly affects dopaminergic neurons in the nigrostriatal system but also several other regions of the brain. Two dominant mutations, A53T and A30P, in ␣-synuclein cause familial early onset PD (1, 2). The function of ␣-synuclein and the pathogenic mechanism of these mutations is unknown, but ␣-synuclein has been detected in Lewy bodies (3-5) and shown to be their major filamentous component (6). Lewy bodies are a pathological hallmark of PD (7-9), and we therefore hypothesized that the PD mutations would cause or enhance ␣-synuclein aggregation. Indeed, a very recent publication demonstrated in vitro fibrillization of A53T mutant but not A30P mutant or wild type ␣-synuclein (10). Here we demonstrate aggregation of all forms of ␣-synuclein. In a complete aggregation time course, we show that there is an aggregation continuum; although all forms of ␣-synuclein do aggregate, aggregation is accelerated for both mutants; A30P aggregates slightly faster than wild type, and A53T aggregates much faster. Because both mutant forms enhance the aggregation tendency observed in the wild type, we hypothesize that aggregation of ␣-synuclein may be important in all forms of PD. EXPERIMENTAL PROCEDURESCloning, Bacterial Expression, and Purification of ␣-Synuclein-A 536-bp human ␣-synuclein cDNA was obtained by polymerase chain reaction amplification from an adult human brain cDNA library using primers corresponding to nucleotides 20 -42 and 532-556 of the published sequence (11). Polymerase chain reaction-based site-directed mutagenesis of this sequence was used to generate the mutant forms A53T/ A30P, and A53T ϩ A30P. For bacterial expression, all 4 forms were amplified using the primers TGTGGTCTAGAAGGAGGAATAACATA-TGGATGTATTCATGAAAGGTCTGTCAAAGGCCAAGGAGGGTGTT-GTG and GGGACCGCGGCTCGAGATTAGGCTTCAGGTTCGTAGTC-TTGATAACCTTCCTCA to alter 3 codons near the 5Ј end and 1 codon near the 3Ј end to more highly utilized Escherichia coli codons. The resulting PCR products were digested with NdeI and XhoI and cloned int...

Therapeutic proteins have a propensity for aggregation during manufacturing, shipping, and storage. The presence of aggregates in protein drug products can induce adverse immune responses in patients that may affect safety and efficacy, and so it is of concern to both manufacturers and regulatory agencies. In this vein, there is a lack of understanding of the physicochemical determinants of immunological responses and a lack of standardized analytical methods to survey the molecular properties of aggregates associated with immune activation. In this review, we provide an overview of the basic immune mechanisms in the context of interactions with protein aggregates. We then critically examine the literature with emphasis on the underlying immune mechanisms as they relate to aggregate properties. Finally, we highlight the gaps in our current understanding of this issue and offer recommendations for future research.

Background: Aggregated biotherapeutics have the potential to induce an immune response.Results: Aggregates can enhance innate and adaptive immune responses of PBMC.Conclusion: The response depends on aggregate type, immunogenicity of the monomer, donor immune status, and high particle numbers in the in vitro assay.Significance: This is the first study showing the impact of aggregate characteristics on the potential immune response of PBMC.

A host of diverse stress techniques was applied to a monoclonal antibody (IgG 2 ) to yield protein particles with varying attributes and morphologies. Aggregated solutions were evaluated for percent aggregation, particle counts, size distribution, morphology, changes in secondary and tertiary structure, surface hydrophobicity, metal content, and reversibility. Chemical modifications were also identified in a separate report (Luo, Q., Joubert, M. K., Stevenson, R., Narhi, L. O., and Wypych, J. (2011) J. Biol. Chem. 286, 25134 -25144). Aggregates were categorized into seven discrete classes, based on the traits described. Several additional molecules (from the IgG 1 and IgG 2 subtypes as well as intravenous IgG) were stressed and found to be defined with the same classification system. The mechanism of protein aggregation and the type of aggregate formed depends on the nature of the stress applied. Different IgG molecules appear to aggregate by a similar mechanism under the same applied stress. Aggregates created by harsh mechanical stress showed the largest number of subvisible particles, and the class generated by thermal stress displayed the largest number of visible particles. Most classes showed a disruption of the higher order structure, with the degree of disorder depending on the stress process. Particles in all classes (except thermal stress) were at least partially reversible upon dilution in pH 5 buffer. High copper content was detected in isolated metal-catalyzed aggregates, a stress previously shown to produce immunogenic aggregates. In conclusion, protein aggregates can be a very heterogeneous population, whose qualities are the result of the type of stress that was experienced.

No abstract

No abstract

Can one protein sequence encode two structures? Oxidative folding of human insulin-like growth factor 1 (IGF-1), a globular protein of 70 residues, is shown to yield two products of similar thermodynamic stability. This observation is of particular interest in light of the recent demonstration that two of the three disulfide bonds in native IGF-1 rearrange in the presence of dithiothreitol [Hober, S., et al. (1992) Biochemistry 31, 1749-1756]. Kinetics of the IGF-1 folding pathway were monitored by high-performance liquid chromatography (rp-HPLC). Disulfide-pairing schemes of intermediates and products were established by peptide mapping. Two disulfide isomers were obtained as products: one with native insulin-like pairing [6-48; 18-61; 47-52] (designated native IGF-1; 60% yield) and the other with alternative pairing [6-47; 18-61; 48-52] (designated IGF-swap; 40% yield). The predominant early intermediate contains the single disulfide 18-61, which is shared in common by the two products. Relative yields of native IGF-1 and IGF-swap are independent of protein concentration under dilute conditions. In the absence of an added thiol reagent, each isomer is stable indefinitely at neutral pH; in the presence of an added thiol reagent, the two isomers interconvert with an Arrhenius activation barrier of 12 kcal/mol. Interconversion does not require complete reduction and yields the same ratio of products as initial folding, demonstrating thermodynamic control. Spectroscopic studies using circular dichroism (CD), infrared spectroscopy (FTIR), two-dimensional 1H-NMR (2D-NMR), and photochemical dynamic nuclear polarization (photo-CIDNP) suggest that IGF-1 and IGF-swap adopt similar secondary structures but distinct tertiary folds. Implications of these observations for understanding the topology of protein-folding pathways are discussed.

In this study, we characterized the chemical modifications in the monoclonal antibody (IgG 2 ) aggregates generated under various conditions, including mechanical, chemical, and thermal stress treatment, to provide insight into the mechanism of protein aggregation and the types of aggregate produced by the different stresses. In a separate study, additional biophysical characterization was performed to arrange these aggregates into a classification system (Joubert, M. K., Luo, Q., Nashed-Samuel, Y., Wypych, J., and Narhi, L. O. (2011) J. Biol. Chem. 286, 25118 -25133). Here, we report that different aggregates possessed different types and levels of chemical modification. For chemically treated samples, metal-catalyzed oxidation using copper showed site-specific oxidation of Met 246 , His 304 , and His 427 in the Fc portion of the antibody, which might be attributed to a putative copper-binding site. For the hydrogen peroxidetreated sample, in contrast, four solvent-exposed Met residues in the Fc portion were completely oxidized. Met and/or Trp oxidation was observed in the mechanically stressed samples, which is in agreement with the proposed model of protein interaction at the air-liquid interface. Heat treatment resulted in significant deamidation but almost no oxidation, which is consistent with thermally induced aggregates being generated by a different pathway, primarily by perturbing conformational stability. These results demonstrate that chemical modifications are present in protein aggregates; furthermore, the type, locations, and severity of the modifications depend on the specific conditions that generated the aggregates.