Parkinson's disease (PD) is a neurodegenerative disorder that is pathologically characterized by the presence of intracytoplasmic Lewy bodies, the major component of which are filaments consisting of ␣-synuclein. Two recently identified point mutations in ␣-synuclein are the only known genetic causes of PD, but their pathogenic mechanism is not understood.Here we show that both wild type and mutant ␣-synuclein form insoluble fibrillar aggregates with antiparallel ␤-sheet structure upon incubation at physiological temperature in vitro. Importantly, aggregate formation is accelerated by both PD-linked mutations. Under the experimental conditions, the lag time for the formation of precipitable aggregates is about 280 h for the wild type protein, 180 h for the A30P mutant, and only 100 h for the A53T mutant protein. These data suggest that the formation of ␣-synuclein aggregates could be a critical step in PD pathogenesis, which is accelerated by the PD-linked mutations.Parkinson's disease is a neurodegenerative disorder that predominantly affects dopaminergic neurons in the nigrostriatal system but also several other regions of the brain. Two dominant mutations, A53T and A30P, in ␣-synuclein cause familial early onset PD (1, 2). The function of ␣-synuclein and the pathogenic mechanism of these mutations is unknown, but ␣-synuclein has been detected in Lewy bodies (3-5) and shown to be their major filamentous component (6). Lewy bodies are a pathological hallmark of PD (7-9), and we therefore hypothesized that the PD mutations would cause or enhance ␣-synuclein aggregation. Indeed, a very recent publication demonstrated in vitro fibrillization of A53T mutant but not A30P mutant or wild type ␣-synuclein (10). Here we demonstrate aggregation of all forms of ␣-synuclein. In a complete aggregation time course, we show that there is an aggregation continuum; although all forms of ␣-synuclein do aggregate, aggregation is accelerated for both mutants; A30P aggregates slightly faster than wild type, and A53T aggregates much faster. Because both mutant forms enhance the aggregation tendency observed in the wild type, we hypothesize that aggregation of ␣-synuclein may be important in all forms of PD. EXPERIMENTAL PROCEDURESCloning, Bacterial Expression, and Purification of ␣-Synuclein-A 536-bp human ␣-synuclein cDNA was obtained by polymerase chain reaction amplification from an adult human brain cDNA library using primers corresponding to nucleotides 20 -42 and 532-556 of the published sequence (11). Polymerase chain reaction-based site-directed mutagenesis of this sequence was used to generate the mutant forms A53T/ A30P, and A53T ϩ A30P. For bacterial expression, all 4 forms were amplified using the primers TGTGGTCTAGAAGGAGGAATAACATA-TGGATGTATTCATGAAAGGTCTGTCAAAGGCCAAGGAGGGTGTT-GTG and GGGACCGCGGCTCGAGATTAGGCTTCAGGTTCGTAGTC-TTGATAACCTTCCTCA to alter 3 codons near the 5Ј end and 1 codon near the 3Ј end to more highly utilized Escherichia coli codons. The resulting PCR products were digested with NdeI and XhoI and cloned int...

Although it is well accepted that the structure of amyloid fibrils is dominated by some form of antiparallel p-sheet, there are few details on the secondary structural arrangements of the constituent peptides and how these peptides pack together in the fibril. We describe here the use of scanning proline mutagenesis to map the secondary structural roles of each residue in amyloidogenic peptide fragments of the Alzheimer's amyloid peptide @IA4. In two series of fragments related to residues 15-23 and 12-26 of @IA4, we show that Pro replacement of any residue in the amyloidogenic sequence LVFFAED, corresponding to residues 17-23, leads to essentially complete loss of fibril formation and to excellent peptide solubility. Since peptidyl-prolyl bonds are incapable of forming standard extended chain conformations, the results suggest that residues 17-23 make up the @-sheet core of the fibrils formed by these fragments. In contrast to the proline replacements, alanine substitutions at residues 17, 18, and 20 have no effect on fibril formation, while replacement of Phe19 reduces fibril formation to 15% of the level found for the wild type sequence. Scanning proline mutagenesis should play a useful role in mapping the secondary structural features of larger amyloidogenic peptide sequences, including longer, physiologically relevant forms of @/A4. In addition, these results suggest explanations for some amyloidogenic effects observed in disease-related peptides and also suggest a possible role for aggregation-inhibiting insertion of prolines in protein evolution and protein design.

No abstract

Parkinson's disease (PD) is a neurodegenerative disorder that is pathologically characterized by the presence of intracytoplasmic Lewy bodies, the major components of which are filaments consisting of ␣-synuclein. Two recently identified point mutations in ␣-synuclein are the only known genetic causes of PD. ␣-Synuclein fibrils similar to the Lewy body filaments can be formed in vitro, and we have shown recently that both PDlinked mutations accelerate their formation. This study addresses the mechanism of ␣-synuclein aggregation: we show that (i) it is a nucleation-dependent process that can be seeded by aggregated ␣-synuclein functioning as nuclei, (ii) this fibril growth follows first-order kinetics with respect to ␣-synuclein concentration, and (iii) mutant ␣-synuclein can seed the aggregation of wild type ␣-synuclein, which leads us to predict that the Lewy bodies of familial PD patients with ␣-synuclein mutations will contain both, the mutant and the wild type protein. Finally (iv), we show that wild type and mutant forms of ␣-synuclein do not differ in their critical concentrations. These results suggest that differences in aggregation kinetics of ␣-synucleins cannot be explained by differences in solubility but are due to different nucleation rates. Consequently, ␣-synuclein nucleation may be the rate-limiting step for the formation of Lewy body ␣-synuclein fibrils in Parkinson's disease.Parkinson's disease (PD) 1 is a neurodegenerative disorder that predominantly affects dopaminergic neurons in the nigrostriatal system but also several other regions of the brain. A pathological hallmark of PD are Lewy bodies (1-3), which also accumulate in dementia with Lewy bodies (4) and multiple system atrophy (5, 6), but not in a variety of other neurodegenerative disorders. The major filamentous component of Lewy bodies is ␣-synuclein (4, 7), a 140-amino acid protein (8). Lately, two dominant mutations in ␣-synuclein causing familial early onset PD have been described (9, 10), suggesting that Lewy bodies contribute mechanistically to the degeneration of neurons in PD. Very recent in vitro studies have shown that recombinant ␣-synuclein can indeed form Lewy body-like fibrils (11-15). Most importantly, both PD-linked ␣-synuclein mutations accelerate this aggregation process (11, 15), which immediately suggests that such in vitro studies may have relevance for PD pathogenesis. We therefore decided to address the kinetic mechanism of ␣-synuclein fibrillogenesis. We have shown before that in a complete aggregation time course ␣-synuclein aggregation is slow and displays a distinct lag phase (15). This might be indicative of a nucleation-dependent polymerization mechanism consisting of an initial lag phase (nucleation) followed by a growth phase (elongation) and a steady state phase in which the ordered aggregate and monomer are at equilibrium. In the lag phase a supersaturated protein solution remains stable while soluble pre-nucleus oligomers build up. Once nuclei are formed, the aggregates grow rapidly (elongation ph...

Peptide deformylase (PDF) is an essential bacterial metalloenzyme which deformylates the N-formylmethionine of newly synthesized polypeptides and as such represents a novel target for antibacterial chemotherapy. To identify novel PDF inhibitors, we screened a metalloenzyme inhibitor library and identified an N-formylhydroxylamine derivative, BB-3497, and a related natural hydroxamic acid antibiotic, actinonin, as potent and selective inhibitors of PDF. To elucidate the interactions that contribute to the binding affinity of these inhibitors, we determined the crystal structures of BB-3497 and actinonin bound to Escherichia coli PDF at resolutions of 2.1 and 1.75 Å, respectively. In both complexes, the active-site metal atom was pentacoordinated by the side chains of Cys 90, His 132, and His 136 and the two oxygen atoms of N-formyl-hydroxylamine or hydroxamate. BB-3497 had activity against gram-positive bacteria, including methicillin-resistant Staphylococcus aureus and vancomycin-resistant Enterococcus faecalis, and activity against some gram-negative bacteria. Time-kill analysis showed that the mode of action of BB-3497 was primarily bacteriostatic. The mechanism of resistance was via mutations within the formyltransferase gene, as previously described for actinonin. While actinonin and its derivatives have not been used clinically because of their poor pharmacokinetic properties, BB-3497 was shown to be orally bioavailable. A single oral dose of BB-3497 given 1 h after intraperitoneal injection of S. aureus Smith or methicillin-resistant S. aureus protected mice from infection with median effective doses of 8 and 14 mg/kg of body weight, respectively. These data validate PDF as a novel target for the design of a new generation of antibacterial agents.Ribosome-mediated synthesis of proteins starts with a methionine residue. In prokaryotes, the amino group of the methionyl moiety carried by the initiator tRNA fMet is N formylated by formyltransferase prior to its incorporation into a polypeptide. Consequently, N-formylmethionine is always present at the N terminus of a nascent bacterial polypeptide. However, most mature proteins do not retain the N-formyl group or the terminal methionine residue. Following translation, the formyl group is hydrolyzed by peptide deformylase (PDF), which is necessary for further processing at the N terminus by methionine aminopeptidase (32). Deformylation is therefore a crucial step in bacterial protein biosynthesis, and PDF is essential for bacterial growth (23). The gene encoding PDF (def) is present in all sequenced pathogenic bacterial genomes and has no mammalian counterpart, making it an attractive target for antibacterial chemotherapy. Although the enzyme has been known for 30 years, it has proved difficult to isolate and characterize due to its apparent instability. Recently, two X-ray crystal structures and a solution structure of PDF have been determined (5, 9, 12), identifying PDF as a new class of metalloenzyme related in structure to the metalloproteinase superfamily. ...

Prior studies suggest that the impaired healing seen in diabetic wounds derives from a state of persistent hyper-inflammation characterized by harmful increases in inflammatory leukocytes including macrophages. However, such studies have focused on wounds at later time points (day 10 or older), and very little attention has been given to the dynamics of macrophage responses in diabetic wounds early after injury. Given the importance of macrophages for the process of healing, we studied the dynamics of macrophage response during early and late phases of healing in diabetic wounds. Here, we report that early after injury, the diabetic wound exhibits a significant delay in macrophage infiltration. The delay in the macrophage response in diabetic wounds results from reduced Chemokine (C-C motif) ligand 2 (CCL2) expression. Importantly, one-time treatment with chemoattractant CCL2 significantly stimulated healing in diabetic wounds by restoring the macrophage response. Our data demonstrate that, rather than a hyper-inflammatory state; the early diabetic wound exhibits a paradoxical and damaging decrease in essential macrophage response. Our studies suggest that the restoration of the proper kinetics of macrophage response may be able to jumpstart subsequent healing stages. CCL2 chemokine-based therapy may be an attractive strategy to promote healing in diabetic wounds.

A unique, protective cell envelope contributes to the broad drug resistance of the nosocomial pathogen Acinetobacter baumannii. Here we use transposon insertion sequencing to identify A. baumannii mutants displaying altered susceptibility to a panel of diverse antibiotics. By examining mutants with antibiotic susceptibility profiles that parallel mutations in characterized genes, we infer the function of multiple uncharacterized envelope proteins, some of which have roles in cell division or cell elongation. Remarkably, mutations affecting a predicted cell wall hydrolase lead to alterations in lipooligosaccharide synthesis. In addition, the analysis of altered susceptibility signatures and antibiotic-induced morphology patterns allows us to predict drug synergies; for example, certain beta-lactams appear to work cooperatively due to their preferential targeting of specific cell wall assembly machineries. Our results indicate that the pathogen may be effectively inhibited by the combined targeting of multiple pathways critical for envelope growth.

Intraneuronal deposition of alpha-synuclein as fibrils and oxidative stress are both implicated in the pathogenesis of Parkinson's disease. We found that the critical rate-limiting step in nucleation of alpha-synuclein fibrils under physiological conditions is the oxidative formation and accumulation of a dimeric, dityrosine cross-linked prenucleus. Dimer formation is accelerated for the pathogenic A30P and A53T mutant alpha-synucleins, because of their greater propensity to self-interact, which is reflected in the smaller values of the osmotic second virial coefficient compared to that of wild-type synuclein. Our finding that oxidation is an essential step in alpha-synuclein aggregation supports a mechanism of Parkinson's disease pathogenesis in which the separately studied pathogenic factors of oxidative stress and alpha-synuclein aggregation converge at the critical step of alpha-synuclein dimer formation.