Yeast genetics and in vitro biochemical analysis have identified numerous genes involved in protein secretion. As compared with yeast, however, the metazoan secretory pathway is more complex and many mechanisms that regulate organization of the Golgi apparatus remain poorly characterized. We performed a genome-wide RNA-mediated interference screen in a Drosophila cell line to identify genes required for constitutive protein secretion. We then classified the genes on the basis of the effect of their depletion on organization of the Golgi membranes. Here we show that depletion of class A genes redistributes Golgi membranes into the endoplasmic reticulum, depletion of class B genes leads to Golgi fragmentation, depletion of class C genes leads to aggregation of Golgi membranes, and depletion of class D genes causes no obvious change. Of the 20 new gene products characterized so far, several localize to the Golgi membranes and the endoplasmic reticulum.
N-Methyl-D-aspartate (NMDA) receptor (NMDAR) activation and downstream signaling are important for neuronal function. Activation of prosurvival Src family kinases and extracellular signal-regulated kinase (ERK) 1/2 is initiated by NMDAR activation, but the cellular organization of these kinases in relation to NMDARs is not entirely clear. We hypothesized that caveolin-1 scaffolds and coordinates protein complexes involved in NMDAR signaling and that this organization is necessary for neuronal preconditioning, whereby NMDAR activation protects neurons from subsequent ischemic cell death. We found that sublethal ischemia (SLI) or preconditioning via NMDA treatment of primary cortical neurons from neonatal rats or mice increases expression of phosphorylated (P) caveolin-1, P-Src, and P-ERK1/2. The NMDAR antagonist, MK801, or the Src inhibitor, PP2, attenuated SLI-induced preconditioning. NMDAR2B distributed to buoyant fractions and heavy fractions, partially colocalized with caveolin-1 and the membrane raft marker, cholera toxin B. Cultures of primary neurons treated with caveolin-1 small interfering RNA or from caveolin-1(-/-) mice lacked the NMDA-mediated increase in P-Src and P-ERK, as well as SLI- and NMDA-induced preconditioning. Adenovirally mediated expression of caveolin-1 in neurons from caveolin-1(-/-) mice restored NMDA-mediated enhancement of P-Src and P-ERK1/2, redistributed NMDAR2B to buoyant fractions, and enhanced NMDAR2B localization to membrane rafts. We conclude that caveolin-1, perhaps via its ability to scaffold key signaling components, is essential for NMDAR localization to neuronal membrane rafts, NMDAR/Src tyrosine kinase family/ERK signaling, and protection of neurons from ischemic injury and cell death.
Decreased expression of prosurvival and progrowth-stimulatory pathways, in addition to an environment that inhibits neuronal growth, contribute to the limited regenerative capacity in the central nervous system following injury or neurodegeneration. Membrane/lipid rafts, plasmalemmal microdomains enriched in cholesterol, sphingolipids, and the protein caveolin (Cav) are essential for synaptic development/stabilization and neuronal signaling. Cav-1 concentrates glutamate and neurotrophin receptors and prosurvival kinases and regulates cAMP formation. Here, we show that primary neurons that express a synapsin-driven Cav-1 vector (SynCav1) have increased raft formation, neurotransmitter and neurotrophin receptor expression, NMDA-and BDNF-mediated prosurvival kinase activation, agonist-stimulated cAMP formation, and dendritic growth. Moreover, expression of SynCav1 in Cav-1 KO neurons restores NMDA-and BDNF-mediated signaling and enhances dendritic growth. The enhanced dendritic growth occurred even in the presence of inhibitory cytokines (TNF␣, IL-1) and myelin-associated glycoproteins (MAG, Nogo). Targeting of Cav-1 to neurons thus enhances prosurvival and progrowth signaling and may be a novel means to repair the injured and neurodegenerative brain.Multiple signaling pathways have been identified that promote growth and survival of neurons and thereby facilitate the formation of synaptic connections that are essential for learning, memory, and the development of the CNS (1-3). Neurotransmitter and neurotrophic receptors, non-receptor tyrosine kinases, and other signaling mediators aggregate to mold and shape postsynaptic densities to permit high-fidelity signal transduction and the regulation of neuronal function (4 -6). A major non-protein component of synapses is cholesterol, which can be a limiting factor in synapse development, synaptic activity, and transmitter release (7).Increasing evidence shows that membrane/lipid rafts, discrete regions of the plasma membrane enriched in cholesterol, glycosphingolipids, and sphingomyelin organize prosurvival and progrowth neuronal signaling pathways (8 -10), regulate cAMP formation (11), and are essential for synapse development, stabilization, and maintenance (7, 12). Caveolin (Cav), 2 a cholesterol binding protein and scaffolding protein found within membrane/lipid rafts (13), organizes and targets certain neuronal growth-promoting proteins, such as components of the neurotransmitter and neurotrophic receptor signaling pathways, to membrane/lipid rafts. These include NMDA receptors, AMPA receptors, Trk receptors, GPC receptors, and Src family kinases (9, 14 -16). These receptors and signaling molecules can enhance cAMP formation, an essential second messenger for promoting neuronal growth and dendritic arborization (17-21), and are found within membrane/lipid rafts in growth cones (6). In the setting of traumatic brain injury and neurodegenerative disorders, interventions that activate signaling pathways to stimulate cAMP production thus have the potential to improve...
Background Propofol exposure to neurons during synaptogenesis results in apoptosis leading to cognitive dysfunction in adulthood. Previous work from our laboratory showed that isoflurane neurotoxicity occurs through p75 neurotrophin receptor (p75NTR) and subsequent cytoskeleton depolymerization. Given that isoflurane and propofol both suppress neuronal activity, we hypothesized that propofol also induces apoptosis in developing neurons through p75NTR. Methods DIV5-7 neurons were exposed to propofol (3 µM) for 6 hr and apoptosis was assessed by cleaved caspase-3 (Cl-Csp3) immunoblot and immunofluorescence microscopy. Primary neurons from p75NTR−/− mice or wild-type neurons were treated with propofol, with or without pretreatment with TAT-Pep5 (10 µM, 15 min), a specific p75NTR inhibitor. P75NTR−/− neurons were transfected for 72 h with a lentiviral vector containing the synapsin driven p75NTR gene (Syn-p75NTR) or control vector (Syn-GFP) prior to propofol. To confirm our in vitro findings, wild type mice and p75NTR−/− mice (PND5) were pre-treated with either TAT-Pep5 or TAT-ctrl followed by propofol for 6 h. Results Neurons exposed to propofol showed a significant increase in Cl-Csp3, an effect attenuated by TAT-Pep5 and hydroxyfasudil. Apoptosis was significantly attenuated in p75NTR−/− neurons. In p75NTR−/− neurons transfected with Syn-p75NTR, propofol significantly increased Cl-Csp3 in comparison to Syn-GFP transfected p75NTR−/− neurons. Wild type mice exposed to propofol exhibited increased Cl-Csp3 in the hippocampus, an effect attenuated by TAT-Pep5. By contrast, propofol did not induce apoptosis in p75NTR−/− mice. Conclusion These results demonstrate that propofol induces apoptosis in developing neurons in vivo and in vitro and implicate a role for p75NTR and the downstream effector ROCK.
Corticostriatal atrophy is a cardinal manifestation of Huntington's disease (HD). However, the mechanism(s) by which mutant huntingtin (mHTT) protein contributes to the degeneration of the corticostriatal circuit is not well understood. We recreated the corticostriatal circuit in microfluidic chambers, pairing cortical and striatal neurons from the BACHD model of HD and its WT control. There were reduced synaptic connectivity and atrophy of striatal neurons in cultures in which BACHD cortical and striatal neurons were paired. However, these changes were prevented if WT cortical neurons were paired with BACHD striatal neurons; synthesis and release of brain-derived neurotrophic factor (BDNF) from WT cortical axons were responsible. Consistent with these findings, there was a marked reduction in anterograde transport of BDNF in BACHD cortical neurons. Subunits of the cytosolic chaperonin T-complex 1 (TCP-1) ring complex (TRiC or CCT for chaperonin containing TCP-1) have been shown to reduce mHTT levels. Both CCT3 and the apical domain of CCT1 (ApiCCT1) decreased the level of mHTT in BACHD cortical neurons. In cortical axons, they normalized anterograde BDNF transport, restored retrograde BDNF transport, and normalized lysosomal transport. Importantly, treating BACHD cortical neurons with ApiCCT1 prevented BACHD striatal neuronal atrophy by enhancing release of BDNF that subsequently acts through tyrosine receptor kinase B (TrkB) receptor on striatal neurons. Our findings are evidence that TRiC reagentmediated reductions in mHTT enhanced BDNF delivery to restore the trophic status of BACHD striatal neurons., a genetically defined progressive neurodegenerative disorder, is characterized by abnormal involuntary movements, cognitive disability, and psychiatric symptoms (1). The pathogenesis of HD is due to an expanded CAG repeat in the huntingtin (HTT) gene, which encodes the protein Htt. Mutant Htt (mHTT) features an increased number of glutamines (Q > 36) near the N terminus. The striking atrophy and loss of striatal medium-sized spiny neurons (MSNs) in the HD brain are accompanied by atrophy of the cortex (2). The mechanisms by which mHTT induces dysfunction and death of neurons are actively explored (3). It has been shown that mHTT has an impact on axonal trafficking and signaling, synaptic function, gene expression, mitochondrial function, calcium homeostasis, and proteostasis (4, 5). Thus, mHTT plays a central role in HD pathogenesis, an assertion fully supported by recent studies in the BACHD model of HD (6).One productive line of inquiry regarding HD pathogenesis focuses on brain-derived neurotrophic factor (BDNF), which sustains neurons of the corticostriatal circuit (7-10). In the corticostriatal circuit, BDNF is produced in cortical neurons and is transported anterogradely in axons before secretion in striatum. Released BDNF binds to tyrosine receptor kinase B (TrkB) on striatal MSNs, resulting in BDNF-mediated signaling. Because MSNs do not produce BDNF, they are largely dependent on cortical neurons for i...
BackgroundAcute brain injury is an important health problem. Given the critical position of caspase 8 at the crossroads of cell death pathways, we generated a new viable mouse line (Ncasp8 −/−), in which the gene encoding caspase 8 was selectively deleted in neurons by cre-lox system.Methodology/Principal FindingsCaspase 8 deletion reduced rates of neuronal cell death in primary neuronal cultures and in whole brain organotypic coronal slice cultures prepared from 4 and 8 month old mice and cultivated up to 14 days in vitro. Treatments of cultures with recombinant murine TNFα (100 ng/ml) or TRAIL (250 ng/mL) plus cyclohexamide significantly protected neurons against cell death induced by these apoptosis-inducing ligands. A protective role of caspase 8 deletion in vivo was also demonstrated using a controlled cortical impact (CCI) model of traumatic brain injury (TBI) and seizure-induced brain injury caused by kainic acid (KA). Morphometric analyses were performed using digital imaging in conjunction with image analysis algorithms. By employing virtual images of hundreds of brain sections, we were able to perform quantitative morphometry of histological and immunohistochemical staining data in an unbiased manner. In the TBI model, homozygous deletion of caspase 8 resulted in reduced lesion volumes, improved post-injury motor performance, superior learning and memory retention, decreased apoptosis, diminished proteolytic processing of caspases and caspase substrates, and less neuronal degeneration, compared to wild type, homozygous cre, and caspase 8-floxed control mice. In the KA model, Ncasp8 −/− mice demonstrated superior survival, reduced seizure severity, less apoptosis, and reduced caspase 3 processing. Uninjured aged knockout mice showed improved learning and memory, implicating a possible role for caspase 8 in cognitive decline with aging.ConclusionsNeuron-specific deletion of caspase 8 reduces brain damage and improves post-traumatic functional outcomes, suggesting an important role for this caspase in pathophysiology of acute brain trauma.
In this study, we report for the first time the existence of complemented palindromic small RNAs (cpsRNAs) and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs. The first discovered 19-nt cpsRNA UUAACAAGCUUGUUAAAGA, named SARS-CoV-cpsR-19, was detected from a 22-bp DNA complemented palindrome TCTTTAACAAGCTTGTTAAAGA in the severe acute respiratory syndrome coronavirus (SARS-CoV) genome. The phylogenetic analysis supported that this DNA complemented palindrome originated from bat betacoronavirus. The results of RNA interference (RNAi) experiments showed that one 19-nt segment corresponding to SARS-CoV-cpsR-19 significantly induced cell apoptosis. Using this joint analysis of the molecular function and phylogeny, our results suggested that SARS-CoV-cpsR-19 could play a role in SARS-CoV infection or pathogenesis. The discovery of cpsRNAs has paved a way to find novel markers for pathogen detection and to reveal the mechanisms underlying infection or pathogenesis from a different point of view. Researchers can use cpsRNAs to study the infection or pathogenesis of pathogenic viruses when these viruses are not available. The discovery of psRNAs and cpsRNAs, as a novel class of small RNAs, also inspire researchers to investigate DNA palindromes and DNA complemented palindromes with lengths of psRNAs and cpsRNAs in viral genomes.
Preclinical and clinical studies have demonstrated that a free radical scavenger edaravone has neuroprotective effects on ischemic stroke but the underlying mechanism is not fully understood. The aim of this research is to explore the effect of edaravone on the apoptotic process involving the Fas/FasL signaling pathway. Transient focal ischemia in rats was induced for 2 hours by middle cerebral artery occlusion (MCAO). After reperfusion rats were treated i.v. with either edaravone or physiological saline. The expression of Fas-associated death domain protein (FADD), death-associated protein (Daxx) and caspase-8 was examined by immunohistochemistry. The mRNA levels for FADD and Daxx by reverse-transcriptase PCR (RT-PCR) and apoptosis was assessed by terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick end labeling (TUNEL). Neurological scores and infarction volumes were also evaluated. Edaravone significantly improved the neurological outcome (p<0.05) and reduced the total infarct volumes (p<0.05), compared with saline control. In addition, edaravone-treatment significantly reduced the number of TUNEL-positive cells (p<0.01), reduced expression levels of FADD, Daxx and caspase-8 immunoreactivity (p <0.05 approximately 0.01), and decreased mRNA levels of FADD and Daxx (p<0.05 approximately 0.01) within the peri-infarct area. We conclude that edaravone may protect ischemic neurons from apoptosis via suppressing the gene expression of the Fas/FasL signaling pathway.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.