Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus

Abstract

In this study, we report for the first time the existence of complemented palindromic small RNAs (cpsRNAs) and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs. The first discovered 19-nt cpsRNA UUAACAAGCUUGUUAAAGA, named SARS-CoV-cpsR-19, was detected from a 22-bp DNA complemented palindrome TCTTTAACAAGCTTGTTAAAGA in the severe acute respiratory syndrome coronavirus (SARS-CoV) genome. The phylogenetic analysis supported that this DNA complemented palindrome originated from bat betacoronavirus. The results of RNA interference (RNAi) experiments showed that one 19-nt segment corresponding to SARS-CoV-cpsR-19 significantly induced cell apoptosis. Using this joint analysis of the molecular function and phylogeny, our results suggested that SARS-CoV-cpsR-19 could play a role in SARS-CoV infection or pathogenesis. The discovery of cpsRNAs has paved a way to find novel markers for pathogen detection and to reveal the mechanisms underlying infection or pathogenesis from a different point of view. Researchers can use cpsRNAs to study the infection or pathogenesis of pathogenic viruses when these viruses are not available. The discovery of psRNAs and cpsRNAs, as a novel class of small RNAs, also inspire researchers to investigate DNA palindromes and DNA complemented palindromes with lengths of psRNAs and cpsRNAs in viral genomes.

Analysis of factors associated with disease outcomes in hospitalized patients with 2019 novel coronavirus disease

“…[8] Coronavirus has gradually become a popular topic of research in the field of virology because of the outbreak of SARSr-CoV in 2003 and MERSr-CoV in 2012. [9] The current outbreak is due to a novel coronavirus in the b-genus, which was isolated from the lower respiratory tract in patients with unexplained pneumonia, in Wuhan, China. [10,11] Currently, the source and pathogenesis of the COVID-19 remain unclear, and there are no uniform diagnostic and treatment standards.…”

siRNAs Derived from Cymbidium Mosaic Virus and Odontoglossum Ringspot Virus Down-modulated the Expression Levels of Endogenous Genes in Phalaenopsis equestris

“…The results showed that 21-nt siRNA duplexes derived from CymMV and ORSV with 0-nt overhangs were the most abundant 21-nt duplexes, followed by 2-nt overhangs and then 1-nt overhangs 21-nt duplexes in P. equestris (Fig. 2D), which was different from that of other viruses-plant and viruses-invertebrates systems, in which the 21-nt siRNAs duplexes with 2-nt overhands were the most abundance duplexes (Liu et al, 2018; Niu et al, 2017). Thus, the results suggested that 21-nt vsiRNAs duplexes with 0-nt overhangs were the most efficient triggers of RNAi in P. equestris .…”

“…2B and C); however, the majority of siRNAs in many virus-plant systems were 21–24 nt in length, with 21- and 22-nt being also most abundant (Kreuze et al, 2009; Lan et al, 2018b; Li et al, 2016; Mitter et al, 2013; Xu and Zhou, 2017; Yan et al, 2010; Yang et al, 2014). Thus, these results implicated that the homologues of DCL4 and DCL2 in P. equestris may be the predominant DCLs involved in the biogenesis of viral small interfering RNAs (vsiRNAs) which functions as the predominant antiviral silencing mediators (Blevins et al, 2006; Deleris et al, 2006; Ding, 2010; Donaire et al, 2008; Liu et al, 2018; Niu et al, 2017); as for other DCLs of P. equestris participating in vsiRNAs generation will be the future discussed topic. Then, we analyzed the features of 21-nt siRNA duplexes induced by CymMV and ORSV.…”

Special Issue: MicroRNA Regulation in Health and Disease

“…This Special Issue of Genes, entitled "MicroRNA Regulation in Health and Disease" consists of a series of articles spanning the clinical realm from colorectal cancer to pulmonary fibrosis. However, we begin with a research article by Liu et al who reported for the first time the existence of complemented palindromic small RNAs (cpsRNAs) from SARS coronavirus, and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs [7]. Such a discovery of cpsRNAs could pave a way to find novel markers for pathogen detection and to reveal the mechanisms underlying infection or pathogenesis from a different perspective.…”