In this work, we study singlet fission in tetracene para-dimers, covalently linked by a phenyl group. In contrast to most previous studies, we account for the full quantum dynamics of the combined excitonic and vibrational system. For our simulations, we choose a numerically unbiased representation of the molecule’s wave function, enabling us to compare with experiments, exhibiting good agreement. Having access to the full wave function allows us to study in detail the post-quench dynamics of the excitons. Here, one of our main findings is the identification of a time scale t0 ≈ 35 fs dominated by coherent dynamics. It is within this time scale that the larger fraction of the singlet fission yield is generated. We also report on a reduced number of phononic modes that play a crucial role in the energy transfer between excitonic and vibrational systems. Notably, the oscillation frequency of these modes coincides with the observed electronic coherence time t0. We extend our investigations by also studying the dependency of the dynamics on the excitonic energy levels that, for instance, can be experimentally tuned by means of the solvent polarity. Here, our findings indicate that the singlet fission yield can be doubled, while the electronic coherence time t0 is mainly unaffected.

The realization of electrochemiluminescence (ECL) detection at the single-molecule level is a longstanding goal of ECL assay that requires a novel ECL probe with significantly enhanced luminescence. Here, the synergistic effect of electrochemiluminescence (ECL) is observed unprecedentedly in a new cyclometalated dinuclear Ir­(III) complex [Ir2(dfppy)4(imiphenH)]­PF6 (1·PF6, PF6 – = hexafluorophosphate) in which two {Ir­(dfppy)2}+ units are bridged by an imiphenH– ligand. The ECL intensity from complex 1·PF6 is 4.4 and 28.7 times as high as that of its reference mononuclear complexes 2 and 3·PF6, respectively. Theoretical calculation reveals that the S0 to S1 excitation is a local excitation in 1·PF6 with two electron-coupled Ir­(III) centers, which contributes to the enhanced ECL. The synergistic effect of ECL in 1·PF6 can be used to detect microRNA 21 at the single-molecule level (microRNA 21: UAGCUUAUCAGACUGAUGUUGA), with detectable ECL emission from this complex intercalated in DNA/microRNA 21 duplex as low as 90 helix molecules. The finding of the synergistic effect of ECL will not only provide a novel strategy for the modulation of ECL intensity but also enable the detection of microRNA at the single-molecule level.

Singlet fission (SF) is an appealing process where one photoexcited singlet transforms to two triplets, which can overcome thermalization energy loss and improve solar cell efficiency. However, it remains unclear how intermolecular coupling, which is subject to molecular stacking, controls SF pathways and dynamics. Here, we prepared polymorph rubrene single crystals with different stacking geometries, including orthorhombic (Orth.), triclinic (Tri.), and monoclinic (Mono.) phases. By micro‐area ultrafast spectroscopy, we find that Orth. and Tri. phases with closer π‐π stacking exhibit co‐existing coherent and incoherent SF channels while loosely stacked Mono. phase shows only incoherent SF. Furthermore, incoherent SF is thermally activated in Orth. but barrierless in Mono. and Tri. phases. Quantum mechanical calculation reveals that different electronic coupling strength in different phases leads to different SF dynamics. This study demonstrates that molecular stacking governs SF dynamics through electronic coupling, providing guidance for designing efficient SF materials via crystal structural engineering.

There is great interest in the exploitation of singlet fission (SF) materials to improve the power con version efficiency (PCE) of solar cells. Usually ultrafast SF is achieved as an...

Two anthracene-based complexes [Ir(pbt) 2 (aip)]Cl (1) and [Ir(pbt) 2 (aipm)]Cl (2) have been synthesized based on the ligands aip = 2-(9-anthryl)-1H-imidazo[4,5-f ][1,10]phenanthroline, aipm = 2-(9-anthryl)-1 -methyl-imidazo[4,5-f ][1,10]phenanthroline, and pbtH = 2-phenylbenzothiazole in order to explore both the influence of the substituent group R 1 (R 1 = H in 1 and CH 3 in 2) on photo-oxidation activity and photo-oxidation-induced luminescence. Both 1 H NMR spectra and ES mass spectra indicate that the anthracene moiety in complex 1 can be oxidized at room temperature upon irradiation with 365 nm light. Thus, this complex shows photooxidation-induced turn-on yellow luminescence. Compared to 1, complex 2 incorporates an R 1 = CH 3 group, resulting in very weak photo-oxidation activity. On the basis of experimental results and quantum chemical calculation, we report the differences between 1 and 2 in both photo-oxidation behavior and the related luminescence modulation and discuss the relationship between photo-oxidation activity and substituent group R 1 in these complexes.