Single-Molecule MicroRNA Electrochemiluminescence Detection Using Cyclometalated Dinuclear Ir(III) Complex with Synergistic Effect

Abstract

The realization of electrochemiluminescence (ECL) detection at the single-molecule level is a longstanding goal of ECL assay that requires a novel ECL probe with significantly enhanced luminescence. Here, the synergistic effect of electrochemiluminescence (ECL) is observed unprecedentedly in a new cyclometalated dinuclear Ir­(III) complex [Ir2(dfppy)4(imiphenH)]­PF6 (1·PF6, PF6 – = hexafluorophosphate) in which two {Ir­(dfppy)2}+ units are bridged by an imiphenH– ligand. The ECL intensity from complex 1·PF6 is 4.4 and 28.7 times as high as that of its reference mononuclear complexes 2 and 3·PF6, respectively. Theoretical calculation reveals that the S0 to S1 excitation is a local excitation in 1·PF6 with two electron-coupled Ir­(III) centers, which contributes to the enhanced ECL. The synergistic effect of ECL in 1·PF6 can be used to detect microRNA 21 at the single-molecule level (microRNA 21: UAGCUUAUCAGACUGAUGUUGA), with detectable ECL emission from this complex intercalated in DNA/microRNA 21 duplex as low as 90 helix molecules. The finding of the synergistic effect of ECL will not only provide a novel strategy for the modulation of ECL intensity but also enable the detection of microRNA at the single-molecule level.

Novel Porphyrin Zr Metal–Organic Framework (PCN-224)-Based Ultrastable Electrochemiluminescence System for PEDV Sensing

“…It has been widely used in biological immune analysis, medical diagnosis, and food and environmental monitoring and has become one of the important methods of in vitro diagnosis. − ECL luminaries play an important role in ECL analysis. ,− For example, our group used quantum dots, Ru­(bpy) 3 2+ as luminaries to detect the virus. Furthermore, different materials including metal complexes (iridium complexes), , aromatic organic compounds (fluorene, anthracene, perylene, benzooxazole derivatives, and phenothiazine), and nanoparticle complexes have been reported as effective ECL luminaries. ,− However, these materials are toxic or coreactants are harmful to the environment . Based on this motivation, we want to seek nontoxic and environmentally friendly materials.…”

Electrogenerated chemiluminescence detection of single entities

“…Recently, Jiang's group reported ECL detection of single-molecule microRNA. 55 They synthesized a novel ECL probe, a cyclometalated dinuclear Ir( iii ) complex, [Ir 2 (dfppy) 4 (imiphenH)]PF 6 (imiphen = 2-(1 H -Imidazole-2-yl)-1 H -imidazo[4,5- f ][1,10]phenanthroline; PF 6 − = hexafluorophosphate), in which two {Ir(dfppy) 2 } + units are bridged by an imiphenH − ligand. The ECL emitter showed significantly enhanced ECL due to the synergistic effect, which could be mainly attributed to the dinuclear structure of the complex in which two Ir( iii ) centers are bridged by an aromatic organic ligand.…”

Multinuclear 2-(Quinolin-2-yl)quinoxaline-Coordinated Iridium(III) Complexes Tethered by Carbazole Derivatives: Synthesis and Photophysics

“…In comparison to the very well-studied mononuclear Ir­(III) complexes, multinuclear biscyclometalated ionic Ir­(III) complexes are much underdeveloped. ,− The possible intramolecular π–π interactions and/or Ir–Ir communications within these multinuclear complexes can modulate the energy and nature of the excited states and lead to interesting photophysical properties. Various dinuclear Ir­(III) complexes bridged via N^N, C^N, or N^O ligands have been reported .…”

“…Among them, the dinuclear complexes bridged through π-conjugated N^N ligands typically exhibited red-shifted absorption and emission bands compared to their corresponding mononuclear complexes because of the involvement of the bridging ligand-centered (LC) π,π*/intraligand charge-transfer (ILCT) configurations in the excited states ,− or lowering of the 1 MLCT/ 1 LLCT and 3 MLCT/ 3 LLCT (MLCT refers to metal-to-ligand charge transfer, and LLCT denotes ligand-to-ligand charge transfer) states with the increased electron-accepting ability of the bridging ligand . The contribution of the bridging LC transitions also led to enhanced two-photon absorption or synergistic electrochemiluminescence of the dinuclear complexes compared to their mononuclear counterparts. Moreover, the conformational flexibility provided by the bridging ligand caused anion-specific aggregation-induced phosphorescence emission in one ionic dinuclear Ir­(III) complex .…”