No abstract

Heat stress is one of the most important environmental stressors for the poultry industry in the world. Reduced growth rate, low feed efficiency, impaired immunological responses, changes in intestinal microflora, and deterioration of meat quality are the consequences of acute or chronic heat stress. In terms of meat quality, 3 primary mechanisms have been suggested to explain this phenomenon: 1) rapid drop in pH during and after slaughter due to the glycogen conversion to increase in lactic acid accumulation especially when the muscle temperature is high, a combination of high temperature and low pH that facilitates the denaturation of sarcoplasmic proteins resulting in lower water-holding capacity of muscle; 2) acceleration of panting to dissipate body heat, which increases CO2 exhalation and pH drop in blood, initiates metabolic acidosis in skeletal muscle. Increase in panting is also associated with a high release of corticosteroid hormones; 3) the reactive oxygen species produced by heat stress increases the oxidative stress in the birds, which can damage the structure and functions of the enzymes that regulate sarcoplasmic calcium levels in muscles. Overall, these changes in the muscle cells accentuate energy expenditure due to constant muscle contractions. This review discusses the scientific evidence about how heat stress affects the quality of chicken meat through the acid/base status, oxidative reactions, and changes in hormonal secretions.

No abstract

In our original paper, we mistakenly incorporated incorrect catalog information for the TUBB3 antibody into the Key Resources Table . The correct information is as follows: Resource, Anti-TUBB3 antibody (clone TU-20); Source, Millipore; Identifier, Cat#MAB1637; RRID: AB_2210524. We also mistakenly listed incorrect gRNA targeting sequences for ASCL1 in Table S7. The correct information is as follows: gRNA targeting sequence ASCL1 #1, GGAGCACGTCCCCAACGGCGCGG and gRNA targeting sequence ASCL1 #2, GCAAAGAAACAGGCTGCGGGCGG. This information has now been corrected in our article's Key Resources Table and Table S7 online. We apologize for the oversight.

The rapid development of Internet of Things and the related sensor technology requires sustainable power sources for their continuous operation. Scavenging and utilizing the ambient environmental energy could be a superior solution. Here, we report a self-powered helmet for emergency, which was powered by the energy converted from ambient mechanical vibration via a hybridized nanogenerator that consists of a triboelectric nanogenerator (TENG) and an electromagnetic generator (EMG). Integrating with transformers and rectifiers, the hybridized nanogenerator can deliver a power density up to 167.22 W/m(3), which was demonstrated to light up 1000 commercial light-emitting diodes (LEDs) instantaneously. By wearing the developed safety helmet, equipped with rationally designed hybridized nanogenerator, the harvested vibration energy from natural human motion is also capable of powering a wireless pedometer for real-time transmitting data reporting to a personal cell phone. Without adding much extra weight to a commercial one, the developed wearing helmet can be a superior sustainable power source for explorers, engineers, mine-workers under well, as well as and disaster-relief workers, especially in remote areas. This work not only presents a significant step toward energy harvesting from human biomechanical movement, but also greatly expands the applicability of TENGs as power sources for self-sustained electronics.

Lipid oxidation not only negatively influences the sensory characteristics but also the functional characteristics of meat. During the process, various primary and secondary by-products are formed depending upon the types of fatty acids, oxygen availability, and the presence of pro-and antioxidants. Some of the lipid oxidation products only influence the quality of meat but others are implicated to various diseases and human health. Therefore, prevention of lipid oxidation in meat is important for meat quality and for human health as well. The imbalance of oxidants and antioxidants that favors oxidants in the biological system is called oxidative stress in the body. Although the body is equipped with defense enzymes and antioxidant compounds, there are many sources of oxidants or free radicals that can destroy the oxidants/antioxidants balance. Therefore, supply of extra antioxidants through food can help maintaining the balance in favor of antioxidants and help preventing various diseases and malfunctions of our body.

Carcinogenic, water-insoluble Ni compounds are phagocytized by cells; and the particles undergo dissolution inside the cell, releasing Ni ions that interact with chromatin. Ni produces highly selective damage to heterochromatin. The longest contiguous region of heterochromatin in the Chinese hamster genome is found on the q arm of the X chromosome, and this region is selectively damaged by Ni. More than half of the male mice in which there were Ni-induced transformations of Chinese hamster cells exhibited complete deletion of the long arm of the X chromosome. The introduction of a normal X chromosome into these cells resulted in cellular senescence, suggesting that the Ni interacted with Chinese hamster genome to inactivate a senescence gene. Investigations were conducted into the mechanisms by which Ni produced damage to chromatin. Ni ions have a much higher affinity for proteins and amino acids than for DNA (by five to seven orders of magnitude). Therefore, Ni interacted with chromatin because of the protein present, not because of its reactivity for DNA. Studies have shown that Ni produced an increase in oxidative products in cells as indicated by oxidation of the fluorescent dye dichlorofluorescein; Ni has also been shown to produce oxidation of proteins in cells, as measured by carbonyl formation. Ni cross-linked certain amino acids and proteins to DNA. These covalent cross-links were not dissociated by EDTA and are inconsistent with direct Ni involvement, but they are consistent with Ni acting catalytically. Using subtractive hybridization, we have isolated a number of clones that are expressed in normal but not in Ni-transformed cells.(ABSTRACT TRUNCATED AT 250 WORDS)

No abstract