A number of new amidooxime based manganese(II) complexes have been synthesized and characterized by single crystal X‐ray diffraction studies as well as by geometry optimization of complex 2 using DFT/B3LYP. All four complexes (1‐4) are mononuclear having octahedral geometry. DNA binding interaction and nuclease activity of these compounds were investigated for diverse biomedical applications. The results of photophysical studies indicated that the Mn(II) compounds bind with DNA by intercalation mode and the complex 1 containing pyrimidine moiety and chloro ligation showed highest binding affinity. The binding affinities of these compounds were of the order of 104‐105 M−1 and all of them were found to be capable of inducing DNA cleavage.
Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV-vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5'-(GGGTTAGGGTTAGGGTTAGGG)-3' was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10 M], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10 M, and that of BER was (0.98 ± 0.03) × 10 M. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex-berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.
The multifunctional ligand NO2-H2SALNN has been synthesized and employed for the selective fluorometric detection of methanol and its interaction with DNA.
The synthesized Schiff base ligand
3-hydroxy-
N
′-(2-hydroxy-3-methoxybenzylidene)-2-naphthohydrazide
(H
2
NPV) is structurally characterized by single-crystal
X-ray
diffraction (XRD) and exhibits weak fluorescence in the excited state
owing to the effect of excited-state-induced proton transfer (ESIPT).
However, in the presence of Al
3+
, the ESIPT is blocked
and chelation-enhanced fluorescence (CHEF) is induced because of complexation
with the cations, resulting in turn-on emission for Al
3+
. The probe H
2
NPV selectively detects Al
3+
among
the various metal ions, and the detection limit is found to be 1.70
μM. The composition and modes of complex coordination were determined
by spectroscopic, theoretical studies and molecular logic gate applications.
Finally, DNA binding studies were performed by spectroscopic and calorimetric
methods to elucidate possible bioactivity of H
2
NPV.
Two ZnII-based metal organic
frameworks (MOFs) [Zn
2
(L)
2
(1,2-bis(4-pyridyl)ethane)
4
]
n
[(ZnMOF1)] and [Zn
2
(L)
2
(1,2-bis(4-pyridyl)ethene)
4
]
n
[(ZnMOF2)] have been synthesized and crystallographically
characterized. Due to the presence of Lewis acidic center Zn and basic
functional groups (−NN) in both complex [(ZnMOF1)] and [(ZnMOF2)], it is possible
to efficiently fix carbon dioxide into epoxides to produce biosource
cyclic carbonates. Under solvent-free and mild reaction conditions
(60 °C temperature and 1 bar CO2 pressure), various
types of epoxides (terminal as well as internal epoxides) effectively
undergo this catalytic reaction and produced high yield of the corresponding
cyclic carbonate products. High turnover frequency was obtained for
this CO2 fixation reaction of different epoxides, and the
values are in the range of 72–234 h–1. The
theoretical calculations are made by density functional theory (DFT)
theory to achieve the relative energy of the intermediates and transition
state and product which are engaged in each step of the catalytic
reaction cycle, and the detailed mechanism of the reaction is presented.
Moreover, the two MOF catalysts are easily recoverable and recyclable
in nature. The efficiencies of both catalysts regain even after seven
consecutive catalytic cycles. Overall, the work demonstrates the design
and syntheses of two Zn(II)MOF catalysts for effective addition of
CO2 into epoxides to produce cyclic carbonates and DFT
study for the catalytic reaction mechanism.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.