Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Abstract

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV-vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5'-(GGGTTAGGGTTAGGGTTAGGG)-3' was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10 M], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10 M, and that of BER was (0.98 ± 0.03) × 10 M. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex-berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.

Adaptable DNA-Interactive Probe Proficient at Selective Turn-On Sensing for Al3+: Insight from the Crystal Structure, Photophysical Studies, and Molecular Logic Gate

“…UV–vis absorbance is the most widely utilized technique for distinguishing the association of small/little molecules with nucleic acids and production of their complexes. 38 Normally, the absorption change and the shift in the peak location are noticed when a complex generates by the interaction of a small ligand/molecule with DNA. The efficacy of interactions is associated with the extent of variations of peak or shift in absorbance spectrum.…”

“…These types of changes in absorption spectra mostly indicate the existence of an effective association between the π-electron cloud of the interfacing ligand and the base pairs of DNA. 38 − 40 …”

New DNA-Interactive Manganese(II) Complex of Amidooxime: Crystal Structure, DFT Calculation, Biophysical and Molecular Docking Studies

“…Stoichiometry for the complexation of compound 1 with DNA was determined by the continuous variation method (Job’s plot) . The fluorescence signal was recorded for solutions where the concentrations of both DNA and 1 were varied, while the sum of their concentrations was kept fixed.…”

“…The molar ellipticity values [θ] were calculated from the equation [θ] = 100 × θ/( C × l ), where C is the concentration in moles/lit, and l is the cell path length of the cuvette in cm. The molar ellipticity [θ] (deg cm 2 /dmol) values are expressed in terms of base pairs …”

“…The corresponding dilution study was performed injecting same volumes of the identical concentration of 1 into the buffer alone in a separate experiment. The heats of dilution (control heats) were subtracted and the data fitted using the Origin software to a “one set of binding sites” model. ,, The corrected injection heats were thereafter plotted as a function of the molar ratio to calculate the equilibrium constant ( K ), the binding stoichiometry ( N ), the standard molar enthalpy change (Δ H 0 ) of association, and standard molar entropy changes (Δ S 0 ). The standard molar Gibbs energy change (Δ G 0 ) was calculated using the standard relationship where R (1.9872036 cal K –1 mol –1 ) is the gas constant, and T is the temperature in Kelvins (K).…”