BackgroundInteraction of the iminium and alkanolamine forms of sanguinarine with bovine serum albumin (BSA) was characterized by spectroscopic and calorimetric techniques.Methodology/Principal FindingsFormation of strong complexes of BSA with both iminium and alkanolamine forms was revealed from fluorescence quenching of sanguinarine. Binding parameters calculated from Stern-Volmer quenching method revealed that the neutral alkanolamine had higher affinity to BSA compared to the charged iminium form. Specific binding distances of 3.37 and 2.38 nm between Trp 212 (donor) and iminium and alkanolamine forms (acceptor), respectively, were obtained from Forster resonance energy transfer studies. Competitive binding using the site markers warfarin and ibuprofen, having definite binding sites, demonstrated that both forms of sanguinarine bind to site I (subdomain IIA) on BSA. Sanguinarine binding alters protein conformation by reducing the α-helical organization and increasing the coiled structure, indicating a small but definitive partial unfolding of the protein. Thermodynamic parameters evaluated from isothermal titration calorimetry suggested that the binding was enthalpy driven for the iminium form but favoured by negative enthalpy and strong favourable entropy contributions for the alkanolamine form, revealing the involvement of different molecular forces in the complexation.Conclusions/SignificanceThe results suggest that the neutral alkanolamine form binds to the protein more favourably compared to the charged iminium, in stark contrast to the reported DNA binding preference of sanguinarine.

The putative anticancer alkaloids berberine, palmatine, jatrorrhizine, and sanguinarine are known to bind to nucleic acids. To develop them as potential drugs for therapeutic use, their binding affinity to functional proteins and mode of transport in the circulatory system need to be clearly understood. Towards this, many studies on their binding aspects to proteins have been reported and a considerable amount of data, mostly of biophysical nature, exists in the literature. The importance of these natural isoquinoline alkaloids and the recent literature on their interaction phenomena with functional proteins, serum albumins, hemoglobin, and lysozyme are presented in this review.

No abstract

The thermodynamics of the interaction of two pharmaceutically important isoquinoline alkaloids berberine and palmatine with bovine and human serum albumin was investigated using calorimetric techniques, and the data was supplemented with fluorescence and circular dichroism studies. Thermodynamic results revealed that there was only one class of binding sites for both alkaloids on BSA and HSA. The equilibrium constant was of the order of 10(4) M(-1) for both the alkaloids to serum albumins but the magnitude was slightly higher with HSA. Berberine showed higher affinity over palmatine to both proteins. The binding was enthalpy dominated and entropy favoured for both the alkaloids to BSA and HSA. Salt dependent studies suggested that electrostatic interaction had a significant role in the binding process, the binding affinity reduced as the salt concentration increased. Temperature dependent calorimetric data yielded heat capacity values that suggested the involvement of different molecular forces in the complexation of the two alkaloids with BSA and HSA. 3D fluorescence, synchronous fluorescence and circular dichroism data suggested that the binding of the alkaloids changed the conformation of proteins by reducing their helicity. Destabilization of the protein conformation was also revealed from differential scanning calorimetry studies. Overall, the alkaloids bound strongly to serum albumins, but berberine was a better binder to both serum proteins compared to palmatine.

No abstract

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV-vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5'-(GGGTTAGGGTTAGGGTTAGGG)-3' was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10 M], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10 M, and that of BER was (0.98 ± 0.03) × 10 M. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex-berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.

Telomerase is an enzyme deputed to the maintenance of eukaryotic chromosomes; however, its overexpression is a recognized hallmark of many cancer forms. A viable route for the inhibition of telomerase in malignant cells is the stabilization of G-quadruplex structures (G4) at the 3′ overhang of telomeres. Berberine has shown in this regard valuable G4 binding properties together with a significant anticancer activity and telomerase inhibition effects. Here, we focused on a berberine derivative featuring a pyridine containing side group at the 13th position. Such modification actually improves the binding toward telomeric G-quadruplexes and establishes a degree of selectivity in the interaction with different sequences. Moreover, the X-ray crystal structure obtained for the complex formed by the ligand and a bimolecular human telomeric quadruplex affords a better understanding of the 13-berberine derivatives behavior with telomeric G4 and allows to draw useful insights for the future design of derivatives with remarkable anticancer properties.

No abstract