The discovery of electrically conducting organic crystals and polymers has widened the range of potential optoelectronic materials, provided these exhibit sufficiently high charge carrier mobilities and are easy to make and process. Organic single crystals have high charge carrier mobilities but are usually impractical, whereas polymers have good processability but low mobilities. Liquid crystals exhibit mobilities approaching those of single crystals and are suitable for applications, but demanding fabrication and processing methods limit their use. Here we show that the self-assembly of fluorinated tapered dendrons can drive the formation of supramolecular liquid crystals with promising optoelectronic properties from a wide range of organic materials. We find that attaching conducting organic donor or acceptor groups to the apex of the dendrons leads to supramolecular nanometre-scale columns that contain in their cores pi-stacks of donors, acceptors or donor-acceptor complexes exhibiting high charge carrier mobilities. When we use functionalized dendrons and amorphous polymers carrying compatible side groups, these co-assemble so that the polymer is incorporated in the centre of the columns through donor-acceptor interactions and exhibits enhanced charge carrier mobilities. We anticipate that this simple and versatile strategy for producing conductive pi-stacks of aromatic groups, surrounded by helical dendrons, will lead to a new class of supramolecular materials suitable for electronic and optoelectronic applications.

Natural pore-forming proteins act as viral helical coats and transmembrane channels, exhibit antibacterial activity and are used in synthetic systems, such as for reversible encapsulation or stochastic sensing. These diverse functions are intimately linked to protein structure. The close link between protein structure and protein function makes the design of synthetic mimics a formidable challenge, given that structure formation needs to be carefully controlled on all hierarchy levels, in solution and in the bulk. In fact, with few exceptions, synthetic pore structures capable of assembling into periodically ordered assemblies that are stable in solution and in the solid state have not yet been realized. In the case of dendrimers, covalent and non-covalent coating and assembly of a range of different structures has only yielded closed columns. Here we describe a library of amphiphilic dendritic dipeptides that self-assemble in solution and in bulk through a complex recognition process into helical pores. We find that the molecular recognition and self-assembly process is sufficiently robust to tolerate a range of modifications to the amphiphile structure, while preliminary proton transport measurements establish that the pores are functional. We expect that this class of self-assembling dendrimers will allow the design of a variety of biologically inspired systems with functional properties arising from their porous structure.

994). 13. A PCR processes were performed on a Perkn-Elmer GeneAmp PCR system 9600 macnne. For POA processng, 4 pmol of each DNA fragment and 2 unts of A m p T a q DNA polymerase, Stoffel fragment (Perkn-Elmer) In PCR buffer 110 m M trs-HCI, 50 mM KCI, 2.2 m M MgCl,. 0.8 m M deoxynucleotlde trlpnosphate (dNTP). pH 8.3, at 25"CI to a total volume of 40 i*. were processed for 40 cycles (94°C for 30 s, 60°C for 30 s, and 72°C for 30 s). For general PCR. 0.2 i*.l of template sou t o n . 20 pmol of prmers. and 2 unts of Taq DNA polymerase (Gbco-BRL) In PCR buffer [50 m M KCI, 10 m M trls-HCI, 2 mM MgCl,, 10 m M (NH4),S04, 0 8 m M dNTP. pH 8.8, at 2S0C] to a volume of 40 pl were processed for 25 cycles (94°C for 30 s, 65°C for 30 s. and 72°C for 30 s). 14 T i e restrcton enzyme dgest operaton was conducted follow~ng the protocol of New England Boabs.15 T i e mutageness process followed standard protocols (20). (I) \.We added a tall to the ends of answer DNA that IS iomologous (complementary) to parts of M I 3 pnage DNA. PCR v11ti s p e c a y desgned prmers was a p p e d for t n s purpose. One prmer conslsted of 12-bp DNA homologous to M I 3 piage DNA (posltlons 6269 to 6280) and 15 bp of PC (GCT-GGAGCTCCACGTAGAATTCTGCGA); tne other prmer conssted of 12-bp DNA complementary to Mlapnage DNA (postons 6375 to 6386) and 15 bp of P, (GAATTGGGTACCCTGGATCCCGCCC). The frst prmer was phosphoryated at the 5 ' end ~11th T4 polynucleot~de knase (New England Boabs). ( I ) Tne dsDNA of the PCR souton In step (I) was dgested by X exonucease (Gbco-BRL) follow~ng the s u p per's nstructons. The DNA strand that contans a 5 ' piosphate was ihus dgested. ( I ) Mutagenetc M13 pnage DNA (contanng answer DNA) was syntneszed usng the ssDNA from step ( I ) as prmer and wd-type M I 3 pnage DNA as template 16. Transfecton, piage purfcaton, and DNA extracton were conducted follow~ng standard protocols (20).T i e DNA sequencng was done by tne Rockefeller Unvers~ty Proten/DNA Tecinoogy Center 17. The DNA In t i e data pool was purlfled by etianol precptaton, T i e ssDNA was dgested In S1 nucease buffer (50 m M N&c. 280 m M NaCI. and 4.5 m M ZnSO,) v11ti 2 unts of S1 nucease at room temperature for 2 mln 18. K. A. Eckert and T. A. Kunke. PCR veth hods Appl.

Alignment of lamellar block copolymer microstructure in an electric field was studied. Two mechanisms of alignment are considered: selective electric-field-induced disordering and alignment through movement of defects. The latter mechanism is supported by the findings that, in an aligned sample, defect structures exhibited a highly anisotropic arrangement and were spatially clumped. An analysis of fieldinduced forces on disclination lines and defect walls is presented. Also, defect interactions are considered. Through the interplay between these forces, the alignment process, the kinetics of alignment, and clumping of defects can be rationalized.

Frontal photopolymerization (FPP) offers numerous advantages for the rapid prototyping of microfluidic devices. Quantitative utilization of this method, however, requires a control of the vertical dimensions of the patterned resist material. To address this fundamental problem, we study the ultraviolet (UV) photopolymerization of a series of multifunctional thiolene resists through a combination of experiments and analytical modeling of the polymerization fronts. We describe this nonlinear spatio-temporal growth process in terms of a "minimal" model involving an order parameter phi(x, t) characterizing the extent of monomer-to-polymer conversion, the optical attenuation T(x, t), and the solid front position h(t). The latter exhibits an induction time (or equivalent critical UV dose) characterizing the onset of frontal propagation. We also observe a novel transition between two logarithmic rates of growth, determined by the Beer-Lambert attenuation constants mu(0) and mu(infinity) of the monomer and fully polymerized material, respectively. The measured frontal kinetics and optical transmission of the thiolene resist materials are consistent with our photopolymerization model, exhibiting both "photodarkening" and "photoinvariant" polymerization. This is apparently the first observation of photodarkening reported in FPP. On the basis of these results, multilevel fluidic devices with controlled height are readily fabricated with modulated illumination. A representative two-level microfluidic device, incorporating a chaotic mixer, a T junction, and a series of controlled flow constrictions, illustrates the practical versatility of this fabrication method.

Colloidal shear thickening presents a significant challenge because the macroscopic rheology becomes increasingly controlled by the microscopic details of short ranged particle interactions in the shear thickening regime. Our measurements here of the first normal stress difference over a wide range of particle volume fraction elucidate the relative contributions from hydrodynamic lubrication and frictional contact forces, which have been debated. At moderate volume fractions we find N1 < 0, consistent with hydrodynamic models, however at higher volume fractions and shear stresses these models break down and we instead observe dilation (N1 > 0), indicating frictional contact networks. Remarkably, there is no signature of this transition in the viscosity, instead this change in the sign of N1 occurs while the shear thickening remains continuous. These results suggest a scenario where shear thickening is driven primarily by the formation of frictional contacts, with hydrodynamic forces playing a supporting role at lower concentrations. Motivated by this picture, we introduce a simple model which combines these frictional and hydrodynamic contributions and accurately fits the measured viscosity over a wide range of particle volume fraction and shear stress. [3] suggesting that contact friction plays a dominant role in colloidal shear thickening, however this assertion is controversial because of contrary evidence. While friction-based models and simulations capture the viscosity increase observed in experiments, other experimental signatures, particularly the stress anisotropy, are at odds with expectations for frictional interactions [4].Shear thickening, where a suspension's viscosity η = σ/γ increases with increasing shear stress σ (or shear rateγ), is important in a wide array of industrial processes and applications, either something to be avoided or a desired, engineered property [5][6][7]. Shear thickening is observed in both granular suspensions, where the particle diameter d is generally d 10 µm, and colloidal suspensions, where d 10 µm. In granular suspensions, the evidence that friction drives shear thickening is well established [8][9][10][11][12][13][14][15][16] but in colloidal suspensions shear thickening is instead commonly attributed to diverging hydrodynamic lubrication forces, which lock particles together in correlated 'hydroclusters' [17][18][19][20][21].A key difference between friction and lubrication forces lies in the stress anisotropy generated by these two types of interactions. This difference is captured by the first normal stress difference N 1 ≡ σ xx − σ zz , where σ ij is the stress tensor for a shear flow in the x direction with a gradient along z. Simulations based on hydrodynamic interactions show that shear-induced distortions of the suspension microstructure and short ranged lubrication forces drive N 1 < 0 [7,18,19,22]. Including repulsive interactions or elastic particle deformations to these hydrodynamic models does not change the sign of N 1 [23][24][25], and N 1 is predicte...

We present the first characterization of single-crystal devices of a new solution processable material that we have previously demonstrated achieves technologically relevant performance in the polycrystalline thin film state. Our studies include growth and investigation of structural, as well as electronic properties of single crystals of 2,8-difluoro-5,11-bis(triethylsilylethynyl) anthradithiophene (diF-TESADT). Field-effect transistors fabricated on the surface of diF-TESADT single crystals exhibit excellent electronic properties: mobility as high as 6 cm2/Vs, large current on/off ratios (I on/I off = 1 × 108), small subthreshold slopes (S = 1 V/dec), and extremely small hysteresis in the current−voltage characteristics. These properties, coupled with solution processability, make diF-TESADT attractive for electronic applications and demonstrate the technological potential of soluble oligomers.

We report a microfluidic instrument to rapidly measure the interfacial tension of multi-component immiscible liquids. The measurement principle rests upon the deformation and retraction dynamics of drops under extensional flow and was implemented for the first time in microfluidics (S. D. Hudson et al., Appl. Phys. Lett., 2005, 87, 081905 (ref. )). Here we describe in detail the instrument design and physics and extend this principle to investigate multicomponent mixtures, specifically two-component drops of adjustable composition. This approach provides fast real-time sigma measurements (on the order of 1 s), the possibility of rapidly adjusting drop composition and utilizes small sample volumes (approximately 10 microL). The tensiometer operation is illustrated with water drops and binary drops (water/ethylene glycol mixtures) in silicone oils. The technique should be particularly valuable for high-throughput characterization of complex fluids.