The discovery of electrically conducting organic crystals and polymers has widened the range of potential optoelectronic materials, provided these exhibit sufficiently high charge carrier mobilities and are easy to make and process. Organic single crystals have high charge carrier mobilities but are usually impractical, whereas polymers have good processability but low mobilities. Liquid crystals exhibit mobilities approaching those of single crystals and are suitable for applications, but demanding fabrication and processing methods limit their use. Here we show that the self-assembly of fluorinated tapered dendrons can drive the formation of supramolecular liquid crystals with promising optoelectronic properties from a wide range of organic materials. We find that attaching conducting organic donor or acceptor groups to the apex of the dendrons leads to supramolecular nanometre-scale columns that contain in their cores pi-stacks of donors, acceptors or donor-acceptor complexes exhibiting high charge carrier mobilities. When we use functionalized dendrons and amorphous polymers carrying compatible side groups, these co-assemble so that the polymer is incorporated in the centre of the columns through donor-acceptor interactions and exhibits enhanced charge carrier mobilities. We anticipate that this simple and versatile strategy for producing conductive pi-stacks of aromatic groups, surrounded by helical dendrons, will lead to a new class of supramolecular materials suitable for electronic and optoelectronic applications.

Natural pore-forming proteins act as viral helical coats and transmembrane channels, exhibit antibacterial activity and are used in synthetic systems, such as for reversible encapsulation or stochastic sensing. These diverse functions are intimately linked to protein structure. The close link between protein structure and protein function makes the design of synthetic mimics a formidable challenge, given that structure formation needs to be carefully controlled on all hierarchy levels, in solution and in the bulk. In fact, with few exceptions, synthetic pore structures capable of assembling into periodically ordered assemblies that are stable in solution and in the solid state have not yet been realized. In the case of dendrimers, covalent and non-covalent coating and assembly of a range of different structures has only yielded closed columns. Here we describe a library of amphiphilic dendritic dipeptides that self-assemble in solution and in bulk through a complex recognition process into helical pores. We find that the molecular recognition and self-assembly process is sufficiently robust to tolerate a range of modifications to the amphiphile structure, while preliminary proton transport measurements establish that the pores are functional. We expect that this class of self-assembling dendrimers will allow the design of a variety of biologically inspired systems with functional properties arising from their porous structure.

The rational design, the synthesis via a new convergent approach, and the characterization of four generations of monodendrons based on the AB3 building block methyl 3,4,5-trishydroxybenzoate are described. The first generation monodendrons are crystalline. The second generation methyl 3,4,5-tris-3‘,4‘,5‘-[tris(n-dodecyloxy)benzyloxy]benzoate (12Gn-AG-CH 3 , n = 2), the corresponding benzyl alcohol (12G2-AG-CH 2 OH) and benzoic acid (12G2-AG), and all higher generation monodendrons with n = 3 and 4 exhibit in addition to the crystal phase an isomorphous cubic liquid-crystalline (LC) phase of Pm3̄n space group. The cubic unit cell parameters of 12G2-AG, 12G3-AG, and 12G4-AG are 68.3, 79.2, and 84.0 Å, respectively. Computed electron density profiles demonstrated that in the cubic phase 12, 6, and 2 monodendrons of generation 2, 3 and 4 are self-assembled in supramolecular dendrimers resembling spherical micelles when they are centered at the corners and the body-center and respectively highly rounded tetrahedra when they are at 1/4 and 3/4 distance along one of the bisectors of each face of the cubic cell. This novel thermotropic LC phase is similar to that of the lyotropic Pm3̄n phase of biological lipids. These supramolecular dendrimers contain a poly(benzyl ether) core dispersed in an aliphatic matrix of nearly uniform density which is made up of the melted terminal long alkyl chains of the monodendrons. The size of the supramolecular dendrimer and of the entire unit cell increases with generation number as a result of a disproportionately large increase in the number of AB3 repeat units relative to the number of terminal alkyl chains in a monodendron which decreases its average cone angle. The present experiments provide the first examples of monodendrons which self-assemble into spherical supramolecular dendrimers forming a thermotropic cubic LC phase.

994). 13. A PCR processes were performed on a Perkn-Elmer GeneAmp PCR system 9600 macnne. For POA processng, 4 pmol of each DNA fragment and 2 unts of A m p T a q DNA polymerase, Stoffel fragment (Perkn-Elmer) In PCR buffer 110 m M trs-HCI, 50 mM KCI, 2.2 m M MgCl,. 0.8 m M deoxynucleotlde trlpnosphate (dNTP). pH 8.3, at 25"CI to a total volume of 40 i*. were processed for 40 cycles (94°C for 30 s, 60°C for 30 s, and 72°C for 30 s). For general PCR. 0.2 i*.l of template sou t o n . 20 pmol of prmers. and 2 unts of Taq DNA polymerase (Gbco-BRL) In PCR buffer [50 m M KCI, 10 m M trls-HCI, 2 mM MgCl,, 10 m M (NH4),S04, 0 8 m M dNTP. pH 8.8, at 2S0C] to a volume of 40 pl were processed for 25 cycles (94°C for 30 s, 65°C for 30 s. and 72°C for 30 s). 14 T i e restrcton enzyme dgest operaton was conducted follow~ng the protocol of New England Boabs.15 T i e mutageness process followed standard protocols (20). (I) \.We added a tall to the ends of answer DNA that IS iomologous (complementary) to parts of M I 3 pnage DNA. PCR v11ti s p e c a y desgned prmers was a p p e d for t n s purpose. One prmer conslsted of 12-bp DNA homologous to M I 3 piage DNA (posltlons 6269 to 6280) and 15 bp of PC (GCT-GGAGCTCCACGTAGAATTCTGCGA); tne other prmer conssted of 12-bp DNA complementary to Mlapnage DNA (postons 6375 to 6386) and 15 bp of P, (GAATTGGGTACCCTGGATCCCGCCC). The frst prmer was phosphoryated at the 5 ' end ~11th T4 polynucleot~de knase (New England Boabs). ( I ) Tne dsDNA of the PCR souton In step (I) was dgested by X exonucease (Gbco-BRL) follow~ng the s u p per's nstructons. The DNA strand that contans a 5 ' piosphate was ihus dgested. ( I ) Mutagenetc M13 pnage DNA (contanng answer DNA) was syntneszed usng the ssDNA from step ( I ) as prmer and wd-type M I 3 pnage DNA as template 16. Transfecton, piage purfcaton, and DNA extracton were conducted follow~ng standard protocols (20).T i e DNA sequencng was done by tne Rockefeller Unvers~ty Proten/DNA Tecinoogy Center 17. The DNA In t i e data pool was purlfled by etianol precptaton, T i e ssDNA was dgested In S1 nucease buffer (50 m M N&c. 280 m M NaCI. and 4.5 m M ZnSO,) v11ti 2 unts of S1 nucease at room temperature for 2 mln 18. K. A. Eckert and T. A. Kunke. PCR veth hods Appl.

High cis content (81-99%) cis-transoidal polyphenylacetylene (PPA) jacketed with amphiphilic self-assembling dendrons, poly[(3,4-3,5)mG2-4EBn] with m = 8, 10, 12, 14, 16, and (S)-3,7-dimethyloctyl, were synthesized by Rh(C triple bond CPh)(nbd)(PPh(3))(2) (nbd = 2,5-norbornadiene)/N,N-(dimethylamino)pyridine (DMAP) catalyzed polymerization of macromonomers. The resulting cylindrical PPAs self-organize into hexagonal columnar lattices with intracolumnar order (Phi(h)(io)) and without (Phi(h)). The polymers with m = 12, 14, and 16 exhibit also a hexagonal columnar crystal phase (Phi(h,k)). The reversible Phi(h,k)-to-Phi(h)(io)-to- Phi(h) phase transition in these dendronized PPAs was analyzed by a combination of differential scanning calorimetry and small and wide-angle X-ray diffraction experiments performed on powder and oriented fibers. In the Phi(h,k) and Phi(h)(io) phases, the dendronized PPAs form helical porous columns. The helical pore disappears in the Phi(h) phase. This change is accompanied by a decrease of the external column diameter that is induced by stretching of the polymer backbone along the axis of the cylinder. The helix sense of the porous PPA is selected by homochiral alkyl dendritic tails. This transition is generated by an unprecedented conversion of the PPA backbone from the cis-cisoidal conformation in the Phi(h,k) and Phi(h)(io) phases to the cis-transoidal conformation in the Phi(h) phase. Under the same conditions, the pristine cis-PPA undergoes cis-trans isomerization and irreversible intramolecular 6pi electrocyclization of 1,3-cis,5-hexatriene sequences followed by chain cleavage. These processes are eliminated in the dendronized cis-PPA below its decomposition temperature.

X-ray measurements reveal a crystalline monolayer at the surface of the eutectic liquid Au 82 Si 18 , at temperatures above the alloy's melting point. Surfaceinduced atomic layering, the hallmark of liquid metals, is also found below the crystalline monolayer. The layering depth, however, is threefold greater than that of all liquid metals studied to date. The crystallinity of the surface monolayer is notable, considering that AuSi does not form stable bulk crystalline phases at any concentration and temperature and that no crystalline surface phase has been detected thus far in any pure liquid metal or nondilute alloy. These results are discussed in relation to recently suggested models of amorphous alloys.

The synthesis of 2‐ethynyl‐9‐substituted carbazole and 3‐ethynyl‐9‐substituted carbazole monomers containing first‐generation chiral and achiral dendritic (i.e., minidendritic) substituents, 2‐ethynyl‐9‐[3,4,5‐tris(dodecan‐1‐yloxy)benzyl]carbazole (2ECz), 3‐ethynyl‐9‐[3,4,5‐tris(dodecan‐1‐yloxy)benzyl]carbazole (3ECz), 2‐ethynyl‐9‐{3,4,5‐tris[(S)‐2‐methylbutan‐1‐yloxy]benzyl}carbazole (2ECz*), and 3‐ethynyl‐9‐{3,4,5‐tris[(S)‐2‐methylbutan‐1‐yloxy]benzyl}carbazole (3ECz*), is presented. All monomers were polymerized and copolymerized by stereospecific polymerization to produce cis‐transoidal soluble stereoisomers. A structural analysis of poly(2ECz), poly(2ECz*), poly(3ECz), poly(3ECz*), poly(2ECz*‐co‐2ECz), and poly(3ECz*‐co‐3ECz) by a combination of techniques, including 1H NMR, ultraviolet–visible, and circular dichroism spectroscopy, thermal optical polarized microscopy, and X‐ray diffraction experiments, demonstrated that these polymers had a helical conformation that produced cylindrical macromolecules exhibiting chiral and achiral nematic phases. Individual chains of these cylindrical macromolecules were visualized by atomic force microscopy. © 2002 Wiley Periodicals, Inc. J Polym Sci Part A: Polym Chem 40: 3509–3533, 2002

Structural analysis of three libraries of up to five generations of self-assembling dendrons based on AB(3), AB(2), and combinations of AB(3) with AB(2) building blocks (Percec et al. J. Am. Chem. Soc. 2001, 123, 1302) facilitated the discovery of several nanoscale lattices previously unknown for organic compounds (3-D Pm3n cubic, 3-D P4(2)/mnm tetragonal, and a crystallographically forbidden 12-fold symmetry liquid quasicrystal) and provided fundamental correlations between the molecular structure of the dendron and the shape and the diameter of the supramolecular dendrimers which, in these experiments, were limited to less than 75 A. That study concluded that alternative design principles should be elaborated for the assembly of supramolecular dendrimers of larger dimensions. Here we report design principles, synthesis and analysis of first and higher generations AB(3) and AB(2) self-assembling dendrons, based on various primary structures, and combinations of (AB)(y)-AB(3) and (AB)(y)-AB(2) (i.e., from nondendritic AB where y = 1 to 11 and dendritic AB(3) and AB(2)) building blocks that produced the largest structural (including six new lattices) and dimensional (100 to 217 A diameter) diversity of supramolecular dendrimers.