No abstract

No abstract

Cancer is an effect caused by excessive concentrations of Cu(II) and Cr(VI) metal ions in the body. Including health effects of heavy metal ion poisoning industries arise when humans consume fish from various wastes, dyes, electroplating, paint, and battery. Techniques and processes have been developed to separate heavy metal ions which were very dangerous from water by ion exchange, chemical precipitation, and adsorption. Adsorption has no harmful side effects to health, simple, economical and easy to do. Natural materials can be used as adsorbents including ZSM-5, ZSM-5/TiO2 powder, and membrane. The purpose of this study is to determine the initial, final concentration and the percentage decrease concentration of Cu(II) and Cr(VI) ions in water by ZSM-5/TiO2 powder and membrane with variations gauze type and irradiation time. The results showed that the highest percentage reduction Cu(II) ion and Cr(VI) ion with 0.25% w/v ZSM-5/TiO2 powder during UV irradiation 75 minutes were 74.99% and 16.99%. The highest percentage reduction in Cu (II) and Cr (VI) concentration after passing through the ZSM-5/TiO2 membrane with gauze support 304-400 during 90 minute UV irradiation were 57.72% and 54.65%. As the conclusion ability of ZSM-5/TiO2 powder is greater than the ZSM-5/TiO2 membrane in reducing the concentration of Cu(II) and Cr(VI).

Traditional powder herbs is a heritage from Indonesia used for medication. Requirements of traditional powder herbs are secure, useful and to keep quality so that it doesn't contain microbial. This study aim is to know the total of microbial on a packaging and without packaging herbs production of Banjarmasin. This type of research is Observational Analytical research with a research draft using the Cross Sectional approach method. Samples in this study are packaging and without packaging herbs production of Banjarmasin. Counting total of microbial uses Total Plate Count method. The average total microbial of packing herb sample is 58.90%, while the average total microbial of packaging herb sample is 65.20%. Data were analyzed using the Mann Withney test and the result is 0,462 with p-value<0,05 so there is no significant correlation between packaging herb total microbial.

Abstract. Prastiyanto ME, Rohmah N, Efendi L, Arifin R, Wardoyo FA, Wilson W, Mukaromah AH, Dewi SS, Darmawati S. 2021. Antifungal activities of the rhizome extract of five member Zingiberaceae against Candida albicans and Trichophyton rubrum. Biodiversitas 22: 1509-1513. Fungal infections have now become serious health issues. One of the strategies to avoid the problems of fungal infections is by using natural product from plants that are effective against many human pathogenic fungi. The study portrayed the use of the extracts of plant rhizomes as the alternatives to fight against number of human pathogenic fungi. This research aimed to investigate the antifungal activities of crude ethanol extract of five member of the family Zingiberaceae (Curcuma longa, Alpinia galanga Zingiber officinale. var. rubrum, Zingiber officinale var. officinarum and Zingiber officinale var. amarum), which are widely used as folk medicines against Candida albicans and Trichophyton rubrum. Crude ethanol extracts of five members of Zingiberaceae were evaluated for their antifungal activities and the results were calculated based on the zones of inhibition using the diffusion method. The extract showed antifungal activity against Candida. albicans in the agar well diffusion assay (10.2-27.1 mm inhibition diameter) and against T. rubrum (27.3-44.3 mm inhibition diameter). The data have revealed that all rhizomes have the potential to be developed as antifungal agents, particularly against C. albicans and T. rubrum. Studies on the antifungal activity against yeast-like (C. albicans) and filamentous (T. rubrum) can provide new information about the benefits of members Zingiberaceae as a source of natural antifungal. Researchers can select the type of rhizome that has more potential for further extraction to obtain pure compounds that can be used as antifungals.

Streptococcus iniae has been notorious as a serious tilapia fish pathogen leading to many disease outbreaks in warm water marine aquaculture. An in silico investigation about the potential of virulence genes of S. iniae, sagC and sagD, as biomarkers of the bacterial species, has been carried out. The aim was to determine bacterial biomarkers, which are important to facilitate early rapid diagnosis of S. iniae streptococcal infection in fish and also in humans. First, specific primers were designed from sagC and sagD genes of S. iniae SF1 genomic DNA using Primer3Plus. Next, in silico PCR (Polymerase Chain Reaction) analysis was carried out using the newly designed primers and 117 genomic DNA of streptococci (all species) retrieved from the database. Primers designed from sagC and sagD genes (SagCF: ‘5- TGCTGACCTCCTAAAAGGGC -3’ and SagCR: ‘5- CTATGCGGCGGGTTTAAGGT -3’ as well as SagDF: 5’- GCCAATCCAATCCTGTCATGC -3’ and SagDR: 5’- TGCAGCTTCCATAACCCCTC -3’) could result in a single band of each matching to 558-bp and 590-bp PCR products only from S. iniae. From 116 other streptococcal genomes studied using similar primers have resulted in no amplicon bands. A further check showed that the amplicons were truly part of sagC and sagD genes of S. iniae. These results showed that sagC and sagD genes appeared to be biomarkers of S. iniae, which are potential to be used to facilitate rapid diagnostic of the pathogenic bacterium.

Aspergillus flavus adalah jenis jamur multiseluler yang menghasilkan mikotoksin yang berbahaya bagi manusia dan menyebabkan penyakit Aspergillosis, jamur ini dapat mengkontaminasi bahan pangan dan hasil panen. Penggunaan pestisida kimia sintetis masih digunakan oleh petani sebagai desinfektan untuk hasil panen, Pestisida kimia sintetis dapat menyebabkan gangguan kesehatan seperti keracunan dan gangguan sistem pernafasan bagi petani dan masyarakat. Perlu adanya alternatif untuk meminimalisir penggunaan pestisida kimia sintetis yaitu dengan menggunakan pestisida nabati dengan menggunakan bahan herbal. Salah satu bahan herbal yang dapat digunakan adalah daun sirih merah. Daun sirih merah mengandung senyawa flavonoid, alkaloid, steroid, saponin, triterpenoid, dan tanin yang diperoleh melalui pengekstrakan dengan metode maserasi. Metode penelitian yang digunakan adalah metode difusi (sumuran) dan metode dilusi (konsentrasi hambat minimum dan konsentrasi bunuh minimum). Hasil pengujian metode difusi menunjukan rata-rata diameter zona hambat pertumbuhan jamur Aspergillus flavus pada berbagai konsentrasi yaitu 40, 50, 60, dan 70% b/v adalah 20,62 mm, 23,04 mm, 25,12 mm, dan 27,96 mm. Kesimpulan dari penelitian ini adalah ekstrak daun sirih merah mampu membunuh dan menghambat pertumbuhan Aspergillus flavus.

Boyolali Regency is among districts in Indonesia, which still has poverty issues and receives direct cash assistance from the government. Yet, villages of the regency including Sruni at Musuk sub-district has been known as one of the main producers of fresh cow milk for the Central Java region.There has been no attempt to process fresh milk into food products of higher economic value at Sruni Village. Meanwhile, results of the strengths, weaknesses, opportunities, and threats (SWOT) analysis at Musuk showed that the region has the potential to be developed for dairy industry. Therefore, through socialization program, community empowerment should be initiated by socializing benefits of fermenting cattle milk into yogurt as a probiotic food product. The socialization had been carried out for 12 housewives in the village of Sruni through two small-class seminars in April 2019. Evaluation was conducted by comparing the number of correct answers from participants’ answers recorded on questionnaire given prior and after each of both seminars. Percentage of improved answers were presented in histograms and then analyzed. As results, the first seminar produced in average 47.4% improved answers, while the second seminar could generate in average 27.3% improved answers. The results showed that in general, the conducted socialization program was quite successful in improving understanding of Sruni villagers on the benefits of fermenting cattle milk into yogurt as a probiotic food product.