Uniformly 32P-labeled bacteriophage T5 leucine tRNA has been isolated by two-dimensional gel electrophoresis from phage-infected E. coli cells. Its nucleotide sequence has been determined by conventional techniques using TLC on cellulose for oligonucleotide fractionation: pGGGGCUAUGCUGGAACDGmGDAGACAAUACGGCCUUAGm6AU psi CCGUAGCUUAAAUGCGUGGGAGT psi CGAGUCUCCCUAGCCCCACCAoh. This tRNA has anticodon sequence UAG, which can presumably recognize all the four leucine-specific codons (CUN). The main feature of T5 tRNALeu is the absence of the A10-C25 and C31-psi 39 pairing in the D and anticodon stems, respectively.
Here, we present the nucleotide sequence of the bacteriophage T5 EcoRl/HpaI DNA fragment (27.8%-29.5% Rhoades' map (1)). The fragment contains six tRNA genes. Earlier corresponding transfer RNAs were identified by Hunt et al. (2), and tRNAAs was sequenced (3). Except tRNA genes four ORFs were found, and three of them have suitable RBS which are located on the proper distance from the initiation codons. The promoter sequences upstream the genes for tRNATYr and ORF 42aa were characterized by the cloning in the specialized promoter-probe plasmid pKWIII (the data will be published elsewhere). EMBL accession no. Z14121 Noncoding (RNA-like) strand is presented in the direction 5'-3' from the HpaI site. This sequence is immediately adjacent to the distal part of T5 tRNA gene region we sequenced earlier (4).
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.