Twenty-four isolates of Rhizoctonia solani (teleomorph: Thanatephorus cucumeris) collected from soil, root and collar rot or foliage blight-infected plants from several locations of north India were used for the analysis of variability by using morphological and molecular markers. Among the morphological characters, variation was observed in hyphal cell size. Seventeen isolates produced few to abundant, white to dark brown or black, small to large sclerotia generally in the middle of the colony. Genetic variation was also analysed by using 11 random amplified polymorphic DNA primers (RAPD), four universal rice primers (URPs) and two inter simple sequence repeat (ISSR) markers and fingerprint patterns generated for each isolate. The size of amplified DNA bands ranged from 0.3 to 3.5 kb in all the isolates with RAPD, URP and ISSR markers. The isolates obtained from same hosts and same geographical regions showed similarity in DNA fingerprint profiles barring few exceptions. All the isolates were classified into four groups using DNA markers. A comparison of the data obtained from different markers showed that URPs are superior to RAPD, ISSR and morphological markers in detecting genetic variability among the isolates of R. solani. Hence, use of URP's, which have long primer and higher annealing temperature, would be more sensitive and reliable markers in characterizing genetic diversity in R. solani.www.blackwell-synergy.com

Condom catheter balloon is effective in controlling non-traumatic PPH in 94% cases. It is effective, simple to use, easily available and is a cheap modality to manage non-traumatic postpartum hemorrhage, especially in limited resource settings.

No abstract

No abstract

Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP-PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS-49 was least virulent showing 4.5 infection index while BS-75 was the most virulent with 63.4 infection index. The universal rice primers (URPsÕ) are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS-53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP-2F (5¢GTGTGCGATCAGTTGCTGGG3¢) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP-PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana.

Background Subjective cognitive decline (SCD), characterized by self-experience of deterioration in cognitive performance may be a precursor to Alzheimer’s disease (AD). Given the association of AD with dependence and disability for a long duration, earlier the detection, the sooner people and their families can receive information regarding better management. It is critical to explore disparities amongst racial and ethnic populations with SCD in order to facilitate targeted interventions. The primary objective was to identify disparities in prevalence of SCD amongst Whites, Blacks and Hispanics by select sociodemographic characteristics and functional limitations in a U.S. population-based sample of non-institutionalized adults aged 45 and older. The secondary objective was to assess the association between SCD and select chronic conditions (angina, heart attack, stroke, diabetes, high blood pressure and high cholesterol) by race/ethnicity. Methods Combined data (2015–2018) were obtained from the Behavioral Risk Factor Surveillance System (BRFSS) to conduct a population -based study. Analyses included 179,852 respondents aged 45 years or older who answered the SCD screening question as “yes” (n = 19,276) or “no” (n = 160,576). Descriptive statistics examined sociodemographic characteristics including functional limitations amongst racial/ethnic groups with SCD. Association of SCD with chronic conditions by race/ethnicity was also calculated. Results Overall, 10.8% (CI: 10.6–11.1) of adults aged 45 years or older reported SCD.10.7% Whites, 12.3% Blacks and 9.9% Hispanics experienced SCD. Blacks and Hispanics with SCD were more likely to be in the younger age group (45–54 years), less educated, low income, without access to health care, living alone and with functional limitations. Only half had discussed cognitive decline with a health care professional. Prevalence of selected chronic conditions was significantly higher in all racial/ethnic groups with SCD. Conclusions Demographic trends predict a larger proportion of Hispanics and Blacks with SCD in the coming years. This information can lead to identification of opportunities for addressing negative SCD outcomes in minorities affected by inequitable conditions.

The objective of this study was to use data from the Behavioral Risk Factor Surveillance System (BRFSS) to examine the prevalence of multiple chronic conditions (MCC) by select sociodemographic groups and determine the prevalence of most common MCC dyads and triads among Delaware adults. Combined data for 2011 through 2014 from BRFSS (n = 18,052) were analyzed to determine prevalence of MCC. Delaware adults were categorized as having 0, 1, 2, or 3 or more of the following diagnosed chronic conditions: angina, arthritis, asthma, cancer, chronic kidney disease, chronic obstructive pulmonary disease, diabetes, high blood pressure, high cholesterol, myocardial infarction (heart attack), obesity, or stroke. More than 65% of Delaware adults had at least 1 of the 12 selected chronic conditions. Furthermore, 36.8% of Delaware adults had MCC. The arthritis/obesity dyad and the arthritis/high blood pressure/high cholesterol triad were the 2 most prevalent MCC combinations. The findings of this study contribute information to the field of MCC research.

An Agropyron elongatum-derived leaf rust resistance gene Lr24 located on chromosome 3DL of wheat was tagged with six random amplified polymorphic DNA (RAPD) markers which co-segregated with the gene. The markers were identified in homozygous resistant F 2 plants taken from a population segregating for leaf rust resistance generated from a cross between two near-isogenic lines (NILs) differing only for Lr24. Phenotyping was done by inoculating the plants with pathotype 77-5 of Puccinia triticina. To enable gene-specific selection, three RAPD markers (S1302 609 , S1326 615 and OPAB-1 388 ) were successfully converted to polymorphic sequence characterized amplified region (SCAR) markers, amplifying only the critical DNA fragments co-segregating with Lr24. The SCAR markers were validated for specificity to the gene Lr24 in wheat NILs possessing Lr24 in 10 additional genetic backgrounds including the Thatcher NIL, but not to 43 Thatcher NILs possessing designated leaf rust resistance genes other than Lr24. This indicated the potential usefulness of these SCAR markers in marker assisted selection (MAS) and for pyramiding leaf rust resistance genes in wheat.