We report the first Shiga toxin 2-producing Acinetobacter haemolyticus strain that was isolated from the feces of a 3-month-old infant with bloody diarrhea. Usual enteropathogenic bacteria were not detected. This finding suggests that any Shiga toxin-producing microorganism capable of colonizing the human gut may have the potential to cause illness. CASE REPORTIn November 2001, a 3-month-old male infant was admitted at Pereira Rossell Pediatric Hospital with bloody diarrhea of 12 h evolution without fever or other previous pathologies. The patient was treated empirically with intravenous ceftriaxone and hospitalized for 24 h.Samples of feces were obtained before and after the patient was treated with antibiotics, and they were simultaneously studied at the Microbiology laboratory of the Pereira Rossell Pediatric Hospital and at the Reference laboratory for Shiga toxin-producing Escherichia coli. This last study, done in the context of an institutional program aimed at the regional surveillance of bloody diarrheas and hemolytic-uremic syndrome (HUS) etiology, is the focus of the present article.The presence of Salmonella, Shigella, enteroinvasive E. coli, and enteropathogenic E. coli, Yersinia enterocolitica, and Campylobacter in fecal samples was studied using standard procedures, as previously described (18). The searching of Shiga toxin-producing E. coli (STEC) was done by selective enrichment protocol (9) on Trypticase soy broth (Bacto, Le Pont de Claix, France) with 2.5 mg/liter sodium tellurite and 0.05 mg/liter cefixime (CT-TSB; BioMérieux, Marcy LЈÉtoile, France) and further isolation on MacConkey sorbitol (SMAC) plates (Oxoid, Hampshire, England).The microscopic analysis of the two fecal samples showed a low number of leukocytes (5 to 10 per microscopic field) and did not reveal spiral bacteria that would suggest the presence of Campylobacter spp.The cultures from the first fecal sample developed well in all inoculated media.From the second fecal sample, only 12 colonies (all sorbitol negative) were recovered on a directly inoculated SMAC plate after 48 h of culture. From the enrichment broth, we did not recover any microorganism on the SMAC plate.The microbiological studies did not reveal the presence of usual enteropathogenic bacteria in any of the two samples.Twenty sorbitol-positive colonies plus a lysate from the confluent zone in the SMAC plate of the first sample (nonfermenting colonies were not recovered) and the 12 sorbitolnegative colonies recovered from the second sample were analyzed by PCR, as previously described (13), to detect the presence of Stx1/Stx2-encoding organisms. This PCR was performed with primers VT1A-F (GAAGAGTCCGTGGGATT ACG) and VT1B-R (AGCGATGCAGCTATTAATAA) for stx 1 and with primers VT2A-F (TTAACCACACCCACGGCAGT) and VT2B-R (GCTCTGGATGCATCTCTGGT) for stx 2 .E. coli K-12 C600 E. coli K-12 C600 (F Ϫ thi-1 thr-1 leuB6 lacY1 tonA21 supE44 ⌬ ⌬stx 1 ⌬stx 2 ) and Stx2/Stx1-producing E. coli STEC O157:H7 EDL933 were used as negative and positive controls, respectively, in all PCR as...
We studied 13 extended-spectrum -lactamase (ESBL)-producing enteropathogenic Escherichia coli isolates from children suffering acute diarrhea in Uruguay. ESBL characterization in crude extracts showed a single band at pI 5.4. PCR amplification and sequencing data allowed identification of bla PER-2 and bla TEM-116 . Retrospective analysis suggests that these strains were disseminated in the community, even if unnoticed, prior to their access to the hospital environment more than a decade ago.
We analyzed 90 nonduplicates community-associated methicillin-resistant S. aureus (CA-MRSA) strains isolated from skin and soft-tissue infections. All strains were mecA positive. Twenty-four of the 90 strains showed inducible macrolide-lincosamide-streptogramin B resistance. All strains produced α-toxin; 96% and 100% of them displayed positive results for lukS-F and cna genes, respectively. Eigthy-five strains expressed capsular polysaccharide serotype 8. Six different pulsotypes were discriminated by pulsed-field gel electrophoresis (PFGE) and three predominant groups of CA-MRSA strains (1, 2, and 4) were identified, in agreement with phenotypic and genotypic characteristics. Strains of group 1 (pulsotype A, CP8+, and Panton-Valentine leukocidin (PVL)+) were the most frequently recovered and exhibited a PFGE band pattern identical to other CA-MRSA strains previously isolated in Uruguay and Brazil. Three years after the first local CA-MRSA report, these strains are still producing skin and soft-tissue infections demonstrating the stability over time of this community-associated emerging pathogen.
Whole-genome characterisation in clinical microbiology enables to detect trends in infection dynamics and disease transmission. Here, we report a case of bacteraemia due to Campylobacter fetus subsp. fetus in a rural worker under cancer treatment that was diagnosed with cellulitis; the patient was treated with antibiotics and recovered. The routine typing methods were not able to identify the microorganism causing the infection, so it was further analysed by molecular methods and whole-genome sequencing. The multi-locus sequence typing (MLST) revealed the presence of the bovine-associated ST-4 genotype. Whole-genome comparisons with other C. fetus strains revealed an inconsistent phylogenetic position based on the core genome, discordant with previous ST-4 strains. To the best of our knowledge, this is the first C. fetus subsp. fetus carrying the ST-4 isolated from humans and represents a probable case of zoonotic transmission from cattle.
269 Background: CTGF is highly expressed in pancreatic tumors and is thought to mediate local desmoplasia. FG-3019 is a fully human monoclonal antibody against CTGF. Studies using FG-3019 in murine xenograft models have shown reduced tumor growth and metastasis. Methods: This open-label, dose escalation study assessed the safety and pharmacokinetics of FG-3019 (3, 10, 15, and 25 mg/kg q14D). FG-3019 was initiated on D1 to assess single-agent toxicity. Standard gemcitabine and erlotinib were added on D15. Chemotherapy-naive patients with locally advanced or metastatic adenocarcinoma were eligible. Seventeen subjects (median age 66 yrs) were enrolled: n=4, 3, and 10 at 3, 10, and 15 mg/kg respectively. Enrollment is ongoing in the 25 mg/kg cohort. Seven subjects were female; four were stage 3, and 13 were stage 4. Results: No safety signals were detected with single-agent FG-3019. After beginning chemotherapy, four subjects experienced seven SAEs, which were deemed unrelated to FG-3019 including three deaths: sepsis, suicide, and disease progression. Nine subjects experienced grade 3 AEs, all of which were expected in patients with pancreatic cancer. There were no grade 4 hematologic abnormalities. AEs related to gemcitabine (hematologic, abnormal LFTs) and erlotinib (rash) occurred at a rate and severity consistent with the prescribing information (preliminary data). Steady-state Cmax (median 428, range 236-455 μg/mL), and T1/2 (median 6.6, range 6.3-6.7 days) at the 10 mg/kg dose level were comparable to PK data from subjects in non-oncological trials who received FG-3019 at the same dose level. One subject had a partial response by RECIST criteria for 9.7+ months. Another subject had a minor response for 7.7 months. Three of five subjects with PET scans at baseline and D15 experienced stable to reduced PET activity before starting chemotherapy. The median TTP across all cohorts was 3.7 months (95% CI 1.9-6.2), and the median OS was 9.4 months (95% CI 1.9-10.6). Conclusions: FG-3019 is well tolerated and dose escalation continues. Reduced PET activity after treatment with single-agent FG-3019 may indicate a biological effect of the agent. [Table: see text]
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.