Cerebral deposition of amyloid β peptide (Aβ) is an early and critical feature of Alzheimer's disease. Aβ generation depends on proteolytic cleavage of the amyloid precursor protein (APP) by two unknown proteases: β-secretase and γ-secretase. These proteases are prime therapeutic targets. A transmembrane aspartic protease with all the known characteristics of β-secretase was cloned and characterized. Overexpression of this protease, termed BACE (for beta-site APP-cleaving enzyme) increased the amount of β-secretase cleavage products, and these were cleaved exactly and only at known β-secretase positions. Antisense inhibition of endogenous BACE messenger RNA decreased the amount of β-secretase cleavage products, and purified BACE protein cleaved APP-derived substrates with the same sequence specificity as β-secretase. Finally, the expression pattern and subcellular localization of BACE were consistent with that expected for β-secretase. Future development of BACE inhibitors may prove beneficial for the treatment of Alzheimer's disease.

No abstract

Parkinson's disease (PD) is a neurodegenerative disorder that is pathologically characterized by the presence of intracytoplasmic Lewy bodies, the major component of which are filaments consisting of ␣-synuclein. Two recently identified point mutations in ␣-synuclein are the only known genetic causes of PD, but their pathogenic mechanism is not understood.Here we show that both wild type and mutant ␣-synuclein form insoluble fibrillar aggregates with antiparallel ␤-sheet structure upon incubation at physiological temperature in vitro. Importantly, aggregate formation is accelerated by both PD-linked mutations. Under the experimental conditions, the lag time for the formation of precipitable aggregates is about 280 h for the wild type protein, 180 h for the A30P mutant, and only 100 h for the A53T mutant protein. These data suggest that the formation of ␣-synuclein aggregates could be a critical step in PD pathogenesis, which is accelerated by the PD-linked mutations.Parkinson's disease is a neurodegenerative disorder that predominantly affects dopaminergic neurons in the nigrostriatal system but also several other regions of the brain. Two dominant mutations, A53T and A30P, in ␣-synuclein cause familial early onset PD (1, 2). The function of ␣-synuclein and the pathogenic mechanism of these mutations is unknown, but ␣-synuclein has been detected in Lewy bodies (3-5) and shown to be their major filamentous component (6). Lewy bodies are a pathological hallmark of PD (7-9), and we therefore hypothesized that the PD mutations would cause or enhance ␣-synuclein aggregation. Indeed, a very recent publication demonstrated in vitro fibrillization of A53T mutant but not A30P mutant or wild type ␣-synuclein (10). Here we demonstrate aggregation of all forms of ␣-synuclein. In a complete aggregation time course, we show that there is an aggregation continuum; although all forms of ␣-synuclein do aggregate, aggregation is accelerated for both mutants; A30P aggregates slightly faster than wild type, and A53T aggregates much faster. Because both mutant forms enhance the aggregation tendency observed in the wild type, we hypothesize that aggregation of ␣-synuclein may be important in all forms of PD. EXPERIMENTAL PROCEDURESCloning, Bacterial Expression, and Purification of ␣-Synuclein-A 536-bp human ␣-synuclein cDNA was obtained by polymerase chain reaction amplification from an adult human brain cDNA library using primers corresponding to nucleotides 20 -42 and 532-556 of the published sequence (11). Polymerase chain reaction-based site-directed mutagenesis of this sequence was used to generate the mutant forms A53T/ A30P, and A53T ϩ A30P. For bacterial expression, all 4 forms were amplified using the primers TGTGGTCTAGAAGGAGGAATAACATA-TGGATGTATTCATGAAAGGTCTGTCAAAGGCCAAGGAGGGTGTT-GTG and GGGACCGCGGCTCGAGATTAGGCTTCAGGTTCGTAGTC-TTGATAACCTTCCTCA to alter 3 codons near the 5Ј end and 1 codon near the 3Ј end to more highly utilized Escherichia coli codons. The resulting PCR products were digested with NdeI and XhoI and cloned int...

Tau is a neuronal microtubule-associated protein that promotes microtubule assembly, stability, and bundling in axons. Two distinct regions of tau are important for the tau-microtubule interaction, a relatively well-characterized "repeat region" in the carboxyl terminus (containing either three or four imperfect 18-amino acid repeats separated by 13- or 14-amino acid long inter-repeats) and a more centrally located, relatively poorly characterized proline-rich region. By using amino-terminal truncation analyses of tau, we have localized the microtubule binding activity of the proline-rich region to Lys215-Asn246 and identified a small sequence within this region, 215KKVAVVR221, that exerts a strong influence on microtubule binding and assembly in both three- and four-repeat tau isoforms. Site-directed mutagenesis experiments indicate that these capabilities are derived largely from Lys215/Lys216 and Arg221. In marked contrast to synthetic peptides corresponding to the repeat region, peptides corresponding to Lys215-Asn246 and Lys215-Thr222 alone possess little or no ability to promote microtubule assembly, and the peptide Lys215-Thr222 does not effectively suppress in vitro microtubule dynamics. However, combining the proline-rich region sequences (Lys215-Asn246) with their adjacent repeat region sequences within a single peptide (Lys215-Lys272) enhances microtubule assembly by 10-fold, suggesting intramolecular interactions between the proline-rich and repeat regions. Structural complexity in this region of tau also is suggested by sequential amino-terminal deletions through the proline-rich and repeat regions, which reveal an unusual pattern of loss and gain of function. Thus, these data lead to a model in which efficient microtubule binding and assembly activities by tau require intramolecular interactions between its repeat and proline-rich regions. This model, invoking structural complexity for the microtubule-bound conformation of tau, is fundamentally different from previous models of tau structure and function, which viewed tau as a simple linear array of independently acting tubulin-binding sites.

The novel transmembrane aspartic protease BACE (for Beta-site APP Cleaving Enzyme) is the ␤-secretase that cleaves amyloid precursor protein to initiate ␤-amyloid formation. As such, BACE is a prime therapeutic target for the treatment of Alzheimer's disease. BACE, like other aspartic proteases, has a propeptide domain that is removed to form the mature enzyme. BACE propeptide cleavage occurs at the sequence RLPR2E, a potential furin recognition motif. Here, we explore the role of furin in BACE propeptide domain processing. BACE propeptide cleavage in cells does not appear to be autocatalytic, since an inactive D93A mutant of BACE is still cleaved appropriately. BACE and furin co-localize within the Golgi apparatus, and propeptide cleavage is inhibited by brefeldin A and monensin, drugs that disrupt trafficking through the Golgi. Treatment of cells with the calcium ionophore A23187, leading to inhibition of calcium-dependent proteases including furin, or transfection with the ␣ 1 -antitrypsin variant ␣ 1 -PDX, a potent furin inhibitor, dramatically reduces cleavage of the BACE propeptide. Moreover, the BACE propeptide is not processed in the furin-deficient LoVo cell line; however, processing is restored upon furin transfection. Finally, in vitro digestion of recombinant soluble BACE with recombinant furin results in complete cleavage only at the established E46 site. Taken together, our results strongly suggest that furin, or a furin-like proprotein convertase, is responsible for cleaving the BACE propeptide domain to form the mature enzyme.At the histopathological level, AD 1 is characterized by neurofibrillary tangles and amyloid plaques throughout the parenchyma of the brain, as well as amyloid deposits in the cerebral vasculature (reviewed in Ref.

No abstract

The cerebral deposition of amyloid ␤-peptide is an early and critical feature of Alzheimer's disease. Amyloid ␤-peptide is released from the amyloid precursor protein by the sequential action of two proteases, ␤-secretase and ␥-secretase, and these proteases are prime targets for therapeutic intervention. We have recently cloned a novel aspartic protease, BACE, with all the known properties of ␤-secretase. Here we demonstrate that BACE is an N-glycosylated integral membrane protein that undergoes constitutive N-terminal processing in the Golgi apparatus. We have used a se- , and Cys 330 -Cys 380 ). Despite the conservation of the active site residues and the 30 -37% amino acid homology with known aspartic proteases, the disulfide motif is fundamentally different from that of other aspartic proteases. This difference may affect the substrate specificity of the enzyme. Taken together, both the presence of a transmembrane domain and the unusual disulfide bond structure lead us to conclude that BACE is an atypical pepsin family member.The hallmarks of Alzheimer's disease (AD) 1 pathology are brain plaques and vascular deposits (1) consisting of the 4-kDa amyloid ␤-peptide (A␤) (2). Overproduction of the 42-amino acid form of A␤, A␤42, has been suggested to be the cause of all known cases of familial early onset AD (3), and it is assumed that A␤42 deposition plays an early and critical role in sporadic AD as well. Therefore, A␤ metabolism has attracted considerable interest. In 1987 it was shown (4) that formation of A␤ requires proteolytic cleavage of a large type I transmembrane protein, the ␤-amyloid precursor protein (APP), which is constitutively expressed in most cell types. Over the next decade the proteolytic processing of APP has been studied in great detail in a variety of systems by many groups. Taken together, these studies have shown that A␤ is generated at a low rate by most cells analyzed and that two different proteolytic activities are required for A␤ generation. First, ␤-secretase cleaves APP to generate the N terminus of A␤, and second, ␥-secretase cleaves the C terminus, leading to the release of A␤ (for review see Ref. 5). Studies with intact cells expressing APP and the endogenous secretases have led to conclusions about the properties of the ␤-and ␥-secretases, e.g. their tissue distribution, subcellular localization, substrate requirements (see e.g. Ref. 6) etc., but until recently the identity of both ␤-and ␥-secretase was unknown. This changed when we very recently identified the novel transmembrane aspartic protease BACE as the major ␤-secretase (7). Three subsequently published independent studies (8 -10) have confirmed this conclusion. Here we characterize the BACE protein. We show that BACE is an Nglycosylated integral membrane protein that undergoes constitutive N-terminal processing in the Golgi apparatus. We determine the processing and N-glycosylation sites and the disulfide bonds. Our results demonstrate that BACE is an unusual member of the pepsin family. EXPERIMENTAL PROCEDURESMat...

Tau, MAP2, and MAP4 are members of a microtubuleassociated protein (MAP) family that are each expressed as "3-repeat" and "4-repeat" isoforms. These isoforms arise from tightly controlled tissue-specific and/or developmentally regulated alternative splicing of a 31-amino acid long "inter-repeat:repeat module," raising the possibility that different MAP isoforms may possess some distinct functional capabilities. Consistent with this hypothesis, regulatory mutations in the human tau gene that disrupt the normal balance between 3-repeat and 4-repeat tau isoform expression lead to a collection of neurodegenerative diseases known as FTDP-17 (fronto-temporal dementias and Parkinsonism linked to chromosome 17), which are characterized by the formation of pathological tau filaments and neuronal cell death. Unfortunately, very little is known regarding structural and functional differences between the isoforms. In our previous analyses, we focused on 4-repeat tau structure and function. Here, we investigate 3-repeat tau, generating a series of truncations, amino acid substitutions, and internal deletions and examining the functional consequences. 3-Repeat tau possesses a "core microtubule binding domain" composed of its first two repeats and the intervening inter-repeat. This observation is in marked contrast to the widely held notion that tau possesses multiple independent tubulin-binding sites aligned in sequence along the length of the protein.In addition, we observed that the carboxyl-terminal sequences downstream of the repeat region make a strong but indirect contribution to microtubule binding activity in 3-repeat tau, which is in contrast to the negligible effect of these same sequences in 4-repeat tau. Taken together with previous work, these data suggest that 3-repeat and 4-repeat tau assume complex and distinct structures that are regulated differentially, which in turn suggests that they may possess isoform-specific functional capabilities. The relevance of isoform-specific structure and function to normal tau action and the onset of neurodegenerative disease are discussed.