Filamentous flexuous particles of unusual morphology, previously associated with several ringspot isolates, were detected also in psorosis A and psorosis B isolates by serologically specific electron microscopy using an antiserum to citrus ringspot. Upon partial purification of six ringspot, six psorosis A, and three psorosis B isolates, a specific protein of 47 kDa was detected in most cases, but two isolates (one psorosis A and one ringspot) had a 46 and a 48 kDa-protein, respectively. These differences in molecular masses were observed when purificatiion was done from different host species or from plants co-inoculated with two isolates differing by their protein size. The three t'ypes of protein were serologically related in Western blots. Our results indicate tl~at a common virus wi'th different strains may be involved in psorosis A, psorosis B, and ringspot diseases.
In late summer 2001, field-grown pepper (Capsicum annuum) plants showing chlorotic blotching in leaves and fruits were observed in Benicarló, Castellón, Spain. Enzyme-linked immunosorbent assays of extracts of these plants with a collection of plant virus antisera showed a positive reaction only with Broad bean wilt virus serotype 1 (BBWV-1) antiserum. To confirm BBWV-1 infection, primers B1 (GCTCTTCCCCATATAACTTTC) and B2 (GTCTCTATCTTCTCTTCTTCC) were designed based on the nucleotide sequence of BBWV-1 isolate PV132 (GenBank Accession No. AB018702), and were used for reverse-transcription polymerase chain reaction analysis. RNAs extracted from symptomatic plants yielded a cDNA product of ~500 bp that was not obtained using RNA extracts from healthy plants. The sequence of this cDNA fragment was determined, and it showed ~80% nucleotide identity with a BBWV-1 genomic region, encompassing part of the two coat proteins genes. Amino acid identities were ~94% with BBWV-1 isolates and ~60% with BBWV-2 isolates. BBWV-1 and BBWV-2 are considered different species of the genus Fabavirus. BBWV-1 and BBWV-2 are distributed worldwide and infect a wide range of plants. In the Mediterranean Basin, BBWV-1 has been serologically identified in Jordan, Lebanon, Syria, Egypt, Tunisia, Morocco (2), and Italy (1), but no nucleotide sequence data is available. To our knowledge, this is the first report of BBWV-1 in Spain. References: (1) M. G. Bellardi et al. Plant Dis. 81:959, 1997. (2) K. M. Makkouk et al. Neth. J. Plant Pathol. 96:291, 1990.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.