First Report of Broad bean wilt virus 1 in Spain

Abstract

In late summer 2001, field-grown pepper (Capsicum annuum) plants showing chlorotic blotching in leaves and fruits were observed in Benicarló, Castellón, Spain. Enzyme-linked immunosorbent assays of extracts of these plants with a collection of plant virus antisera showed a positive reaction only with Broad bean wilt virus serotype 1 (BBWV-1) antiserum. To confirm BBWV-1 infection, primers B1 (GCTCTTCCCCATATAACTTTC) and B2 (GTCTCTATCTTCTCTTCTTCC) were designed based on the nucleotide sequence of BBWV-1 isolate PV132 (GenBank Accession No. AB018702), and were used for reverse-transcription polymerase chain reaction analysis. RNAs extracted from symptomatic plants yielded a cDNA product of ~500 bp that was not obtained using RNA extracts from healthy plants. The sequence of this cDNA fragment was determined, and it showed ~80% nucleotide identity with a BBWV-1 genomic region, encompassing part of the two coat proteins genes. Amino acid identities were ~94% with BBWV-1 isolates and ~60% with BBWV-2 isolates. BBWV-1 and BBWV-2 are considered different species of the genus Fabavirus. BBWV-1 and BBWV-2 are distributed worldwide and infect a wide range of plants. In the Mediterranean Basin, BBWV-1 has been serologically identified in Jordan, Lebanon, Syria, Egypt, Tunisia, Morocco (2), and Italy (1), but no nucleotide sequence data is available. To our knowledge, this is the first report of BBWV-1 in Spain. References: (1) M. G. Bellardi et al. Plant Dis. 81:959, 1997. (2) K. M. Makkouk et al. Neth. J. Plant Pathol. 96:291, 1990.

A comparative study of viral infectivity, accumulation and symptoms induced by broad bean wilt virus 1 isolates

“…Information about the biological properties of BBWV-1 isolates, such as host range or induced plant symptoms, is very scarce and unclear. BBWV-1 was reported infecting pepper (Capsicum annuum) (Rubio et al, 2002;Svoboda and Leisova-Svobodova, 2013), Vicia faba (Ferriol et al, 2014) and weed species (Mehle et al, 2008). However, economically important horticultural crops such as tomato (Solanum lycopersicum), melon (Cucumis melo), and cucumber (Cucumis sativus) are reported to be BBWV hosts, but in these cases, the studies did not differentiate between BBWV-1 and BBWV-2 (Lisa et al, 1986;Edwardson and Christie, 1991;Blancard, 2012;Moury and Verdin, 2012).…”

Viruses of Pepper Crops in the Mediterranean Basin

“…In Mediterranean countries, BBWV is frequently found in tomato and pepper plants, especially in France, Italy and Spain. Sequence analyses have demonstrated the presence of BBWV-1 isolates in Spain (Rubio et al, 2002). Infected pepper plants develop mosaic and concentric rings on leaves and fruits.…”

First report of Broad bean wilt virus 1 in Slovenia

“…Immuno-serological electron microscopy (ISEM) (antibodies from DSMZ, Germany) of crude sap extracts confirmed BBWV 1 infection. RT-PCR using BBWV 1 specific primers B1/B2 (Rubio et al ., 2002) produced an amplicon of approximately the expected size (500 bp) from extracts from infected but not healthy plants. The sequence of the amplicon was determined (GenBank Accession No.…”