Obesity is a frequent cause of insulin resistance and poses a major risk for diabetes. Abnormal fat deposition within skeletal muscle has been identified as a mechanism of obesity-associated insulin resistance. We tested the hypothesis that dietary lipid deprivation may selectively deplete intramyocellular lipids, thereby reversing insulin resistance. Whole-body insulin sensitivity (by the insulin clamp technique), intramyocellular lipids (by quantitative histochemistry on quadriceps muscle biopsies), muscle insulin action (as the expression of Glut4 glucose transporters), and postprandial lipemia were measured in 20 morbidly obese patients (BMI ‫؍‬ 49 ؎ 8 [mean ؎ SD] kg ⅐ m ؊2 ) and 7 nonobese control subjects. Patients were restudied 6 months later after biliopancreatic diversion (BPD; n ‫؍‬ 8), an operation that induces predominant lipid malabsorption, or hypocaloric diet (n ‫؍‬ 9). At 6 months, BPD had caused the loss of 33 ؎ 10 kg through lipid malabsorption (documented by a flat postprandial triglyceride profile). Despite an attained BMI still in the obese range (39 ؎ 8 kg ⅐ m ؊2 ), insulin resistance (23 ؎ 3 mol/min per kg of fat-free mass; P < 0.001 vs. 53 ؎ 13 of control subjects) was fully reversed (52 ؎ 11 mol/min per kg of fat-free mass; NS versus control subjects). In parallel with this change, intramyocellular-but not perivascular or interfibrillar-lipid accumulation decreased (1.63 ؎ 1.06 to 0.22 ؎ 0.44 score units; P < 0.01; NS vs. 0.07 ؎ 0.19 of control subjects), Glut4 expression was restored, and circulating leptin concentrations were normalized. In the diet group, a weight loss of 14 ؎ 12 kg was accompanied by very modest changes in insulin sensitivity and intramyocellular lipid contents. We conclude that lipid deprivation selectively depletes intramyocellular lipid stores and induces a normal metabolic state (in terms of insulin-mediated whole-body glucose disposal, intracellular insulin signaling, and circulating leptin levels) despite a persistent excess of total body fat mass.

Summary Adipose tissue expansion involves the enlargement of existing adipocytes, the formation of new cells from committed preadipocytes, and the coordinated development of the tissue vascular network. Here we find that murine endothelial cells (EC) of classic white and brown fat depots share ultrastructural characteristics with pericytes, which are pluripotent and can potentially give rise to preadipocytes. Lineage tracing experiments using the VE-cadherin promoter reveal localization of reporter genes in EC, and also in preadipocytes and adipocytes of white and brown fat depots. Furthermore, capillary sprouts from human adipose tissue, which have predominantly EC characteristics, are found to express Zfp423, a recently identified marker of preadipocyte determination. In response to PPARγ activation, endothelial characteristics of sprouting cells are progressively lost, and cells form structurally and biochemically defined adipocytes. Together these data support an endothelial origin of murine and human adipocytes, suggesting a model for how adipogenesis and angiogenesis are coordinated during adipose tissue expansion.

Mammalian breast adipose tissue is replaced by a milk-secreting gland during pregnancy; the reverse process takes place upon interruption of lactation. Morphological and bromodeoxyuridine studies provide indirect evidence that mouse mammary adipocytes transform into secretory epithelial cells during pregnancy and revert to adipocytes after lactation. By using the Cre-loxP recombination system we show that the mammary gland of whey acidic protein (WAP)-Cre͞R26R mice, in which secretory epithelial cells express the lacZ gene during pregnancy, contains labeled adipocytes during involution. Conversely, adipocyte P2-Cre͞R26R mice, in which adipocytes are labeled before pregnancy, contain labeled secretory epithelial cells during pregnancy. We conclude that reversible adipocyte-to-epithelium and epithelium-to-adipocyte transdifferentiation occurs in the mammary gland of adult mice during pregnancy and lactation.Cre͞LoxP recombination system ͉ X-Gal ͉ morphology

Defective insulin secretion is a feature of type 2 diabetes that results from inadequate compensatory increase of β cell mass and impaired glucose-dependent insulin release. β cell proliferation and secretion are thought to be regulated by signaling through receptor tyrosine kinases. In this regard, we sought to examine the potential proliferative and/or antiapoptotic role of IGFs in β cells by tissuespecific conditional mutagenesis ablating type 1 IGF receptor (IGF1R) signaling. Unexpectedly, lack of functional IGF1R did not affect β cell mass, but resulted in age-dependent impairment of glucose tolerance, associated with a decrease of glucose-and arginine-dependent insulin release. These observations reveal a requirement of IGF1R-mediated signaling for insulin secretion. February 2, 2002, and accepted Although the roles of IGFs in β cells have not been completely elucidated, these ligands and their cognate receptors are both expressed in this tissue (32)(33)(34)(35). Interestingly, the developmental wave of β cell apoptosis observed in neonatal rats (36) is associated with a decrease in IGF-2 expression (32, 37), leading to the suggestion that the IGFs have an antiapoptotic function in β cells. On the other hand, overexpression of IGF-2 in β cells (38), but not in liver (39,40), results in diabetes, presumably through increased insulin production with concomitant downregulation of insulin sensitivity. Received for publicationA potential role for IGF1R acting as a mediator of β cell proliferation through IRS-2 has been implied by observations indicating that the β cell failure observed in Irs2 -/-mice is exacerbated by Igf1r haploinsufficiency (13). However, generalized lack of IGF1R is lethal in the immediate postnatal period (41), thus precluding an extensive analysis of the role of IGF signaling in β cell physiology. To circumvent this limitation and analyze the role of IGF1R in β cells, we have used conditional mutagenesis with the cre/loxP site-specific recombination system to generate mice lacking IGF1R specifically in pancreatic β cells. Here we show that these mutant mice are glucose intolerant and exhibit an insulin secretion defect. MethodsMice. Animals carrying a floxed Igf1r allele (Igf1r lox ) (42) or a null Igf1r allele (Igf1r +/-) (41) and transgenic mice expressing the Cre recombinase under the transcriptional control of the rat insulin-2 promoter (InsPr-Cre) (43) have been described previously. A mating program with Igf1r +/-, Igf1r lox/+ , and InsPr-Cre mice was used to generate progeny of five genotypes: Igf1r +/-, Igf1r lox/+ , Igf1r lox/-, Igf1r ∆lox/-, and Igf1r ∆lox/+ (in which exon 3 sequences have been deleted as a result of Cre-mediated recombination). PCR analysis was used for genotyping. The wild-type, null, and Igf1r lox alleles were detected with primer 5′ CTTCCCAGCTTGCTACTCTAGG 3′ (P1, forward, located upstream of the second loxP site) and 5′ CAGGCTTGCAATGAGACATGGG 3′ (P2, reverse, located downstream of the same loxP site) (Figure 1). The Igf1r ∆lox allele was detected using a ...

Rat periovarian adipose tissue contains unilocular adipocytes and some multilocular adipocytes that, following acclimation to cold, become more numerous and give rise to periovarian brown fat areas. We studied the occurrence and distribution of tyrosine hydroxylase, neuropeptide Y, substance P, calcitonin gene-related peptide, vasoactive intestinal peptide, methionine enkephalin, neurotensin, galanin, and cholecystokinin 9-20 in the nerves of rat periovarian tissue maintained at 20 degrees C (control rats), acclimated at 4 degrees C (cold acclimated rats) and at 28 degrees C (warm-acclimated rats). In the periovarian tissue of control and warm-acclimated rats, tyrosine hydroxylase-like, neuropeptide Y-like, substance P-like and calcitonin gene-related peptide-like immunoreactive elements (putative nerves) were present in the blood vessels. In the periovarian tissue of cold-acclimated rats, we found: (1) a more widespread vascular distribution of these neuropeptides; (2) tyrosine hydroxylase-like and calcitonin gene-related peptide-like immunoreactive elements among paucilocular and multilocular adipocytes (parenchymal-like nerves); (3) vasoactive intestinal peptide-like immunoreactive elements in some arteries. Investigation by EM showed the presence of heterogeneous non-myelinated axons both associated with capillaries and among paucilocular and multilocular adipocytes (parenchymal fibres) in periovarian brown fat areas. In conclusion, periovarian brown fat contains the same neuropeptides, with the same vascular and parenchymal distribution, already seen in typical depots of brown fat.

Defective insulin secretion is a feature of type 2 diabetes that results from inadequate compensatory increase of beta cell mass and impaired glucose-dependent insulin release. beta cell proliferation and secretion are thought to be regulated by signaling through receptor tyrosine kinases. In this regard, we sought to examine the potential proliferative and/or antiapoptotic role of IGFs in beta cells by tissue-specific conditional mutagenesis ablating type 1 IGF receptor (IGF1R) signaling. Unexpectedly, lack of functional IGF1R did not affect beta cell mass, but resulted in age-dependent impairment of glucose tolerance, associated with a decrease of glucose- and arginine-dependent insulin release. These observations reveal a requirement of IGF1R-mediated signaling for insulin secretion.

Autosomal recessive cutis laxa (ARCL) type 2 constitutes a heterogeneous group of diseases mainly characterized by lax and wrinkled skin, skeletal anomalies, and a variable degree of intellectual disability. ALDH18A1-related ARCL is the most severe form within this disease spectrum. Here we report on the clinical and molecular findings of two affected individuals from two unrelated families. The patients presented with typical features of de Barsy syndrome and an overall progeroid appearance. However, the phenotype was highly variable including cardiovascular involvement in the more severe case. Investigation of a skin biopsy of one patient revealed not only the typical alterations of elastic fibers, but also an altered structure of mitochondria in cutaneous fibroblasts. Using conventional sequencing and copy number analysis we identified a frameshift deletion of one nucleotide and a microdeletion affecting the ALDH18A1 gene, respectively, in a homozygous state in both patients. Expression analysis in dermal fibroblasts from the patient carrying the microdeletion showed an almost complete absence of the ALDH18A1 mRNA resulting in an absence of the ALDH18A1 protein. So far, only 13 affected individuals from seven unrelated families suffering from ALDH18A1-related cutis laxa have been described in literature. Our findings provide new insights into the clinical spectrum and show that beside point mutations microdeletions are a possible cause of ALDH18A1-ARCL.

No abstract