Defective insulin secretion in pancreatic β cells lacking type 1 IGF receptor

Abstract

Defective insulin secretion is a feature of type 2 diabetes that results from inadequate compensatory increase of β cell mass and impaired glucose-dependent insulin release. β cell proliferation and secretion are thought to be regulated by signaling through receptor tyrosine kinases. In this regard, we sought to examine the potential proliferative and/or antiapoptotic role of IGFs in β cells by tissuespecific conditional mutagenesis ablating type 1 IGF receptor (IGF1R) signaling. Unexpectedly, lack of functional IGF1R did not affect β cell mass, but resulted in age-dependent impairment of glucose tolerance, associated with a decrease of glucose-and arginine-dependent insulin release. These observations reveal a requirement of IGF1R-mediated signaling for insulin secretion. February 2, 2002, and accepted Although the roles of IGFs in β cells have not been completely elucidated, these ligands and their cognate receptors are both expressed in this tissue (32)(33)(34)(35). Interestingly, the developmental wave of β cell apoptosis observed in neonatal rats (36) is associated with a decrease in IGF-2 expression (32, 37), leading to the suggestion that the IGFs have an antiapoptotic function in β cells. On the other hand, overexpression of IGF-2 in β cells (38), but not in liver (39,40), results in diabetes, presumably through increased insulin production with concomitant downregulation of insulin sensitivity. Received for publicationA potential role for IGF1R acting as a mediator of β cell proliferation through IRS-2 has been implied by observations indicating that the β cell failure observed in Irs2 -/-mice is exacerbated by Igf1r haploinsufficiency (13). However, generalized lack of IGF1R is lethal in the immediate postnatal period (41), thus precluding an extensive analysis of the role of IGF signaling in β cell physiology. To circumvent this limitation and analyze the role of IGF1R in β cells, we have used conditional mutagenesis with the cre/loxP site-specific recombination system to generate mice lacking IGF1R specifically in pancreatic β cells. Here we show that these mutant mice are glucose intolerant and exhibit an insulin secretion defect. MethodsMice. Animals carrying a floxed Igf1r allele (Igf1r lox ) (42) or a null Igf1r allele (Igf1r +/-) (41) and transgenic mice expressing the Cre recombinase under the transcriptional control of the rat insulin-2 promoter (InsPr-Cre) (43) have been described previously. A mating program with Igf1r +/-, Igf1r lox/+ , and InsPr-Cre mice was used to generate progeny of five genotypes: Igf1r +/-, Igf1r lox/+ , Igf1r lox/-, Igf1r ∆lox/-, and Igf1r ∆lox/+ (in which exon 3 sequences have been deleted as a result of Cre-mediated recombination). PCR analysis was used for genotyping. The wild-type, null, and Igf1r lox alleles were detected with primer 5′ CTTCCCAGCTTGCTACTCTAGG 3′ (P1, forward, located upstream of the second loxP site) and 5′ CAGGCTTGCAATGAGACATGGG 3′ (P2, reverse, located downstream of the same loxP site) (Figure 1). The Igf1r ∆lox allele was detected using a ...

Defective IGF2 and IGF1R protein production in embryonic pancreas precedes beta cell mass anomaly in the Goto–Kakizaki rat model of type 2 diabetes

“…Pancreas-specific Igf1 gene deficiency mice exhibited enlarged islets and resistance to diabetes induced by streptozotocin [29]. Beta-cell-specific knockout of Igf1r in mice did not affect beta cell mass, but resulted in agedependent impairment of glucose tolerance and defective glucose-stimulated insulin secretion [30,31]. To investigate whether insulin receptor (INSR) plays a compensatory role in beta cell proliferation in the absence of the IGF1R, Ueki et al created a mouse model in which both Insr and Igf1r are disrupted in beta cells [32].…”

The FoxO transcription factors and metabolic regulation

“…b-cell specific insulin receptor (Ir) knockout mice resulted in progressive glucose intolerance due to impaired insulin secretion [81]. b-cell-specific Igf-1r knockout mice resulted in age-dependent impairment of glucose tolerance, associated with a decrease of glucose-and arginine-dependent insulin release [82,83]. Furthermore, a recent study of b-cell specific 3-phosphoinositide-dependent protein kinase 1 (Pdk1), which is a serine-threonine kinase that mediates signaling downstream of PI 3-kinase, knockout mice demonstrated that Pdk1 is important in maintenance of pancreatic b-cell mass [84].…”

Pdx1 Expression in Irs2-deficient Mouse β-Cells Is Regulated in a Strain-dependent Manner

“…Whereas ␤-cell mass in Irs2 Ϫ/Ϫ mice was reduced to 83% of that in the wild-type mice at the age of 6 weeks, ␤-cell mass in Irs2 Ϫ/Ϫ mice was significantly reduced to 51% at 12 weeks of age (11). Insulin/insulin-like growth factor signaling through IRS and phosphoinositide 3-kinase has been thought to regulate several aspects of ␤-cell function (13)(14)(15)(16)(17). Besides the impaired ␤-cell proliferation in Irs2 Ϫ/Ϫ mice, ablation of p70 s6k1 , an Akt substrate, is associated with a decrease in ␤-cell size (18).…”