Food protein-induced enterocolitis (FPIES) is a non-IgE cell- mediated food allergy that can be severe and lead to shock. Despite the potential seriousness of reactions, awareness of FPIES is low; high-quality studies providing insight into the pathophysiology, diagnosis, and management are lacking; and clinical outcomes are poorly established. This consensus document is the result of work done by an international workgroup convened through the Adverse Reactions to Foods Committee of the American Academy of Allergy, Asthma & Immunology and the International FPIES Association advocacy group. These are the first international evidence-based guidelines to improve the diagnosis and management of patients with FPIES. Research on prevalence, pathophysiology, diagnostic markers, and future treatments is necessary to improve the care of patients with FPIES. These guidelines will be updated periodically as more evidence becomes available.

A dense mucous layer in the large intestine prevents inflammation by shielding the underlying epithelium from luminal bacteria and food antigens. This mucous barrier is organized around the hyperglycosylated mucin MUC2. Here we show that the small intestine has a porous mucous layer, which permitted the uptake of MUC2 by antigen-sampling dendritic cells (DCs). Glycans associated with MUC2 imprinted DCs with anti-inflammatory properties by assembling a galectin-3-Dectin-1-FcγRIIB receptor complex that activated β-catenin. This transcription factor interfered with DC expression of inflammatory but not tolerogenic cytokines by inhibiting gene transcription through nuclear factor-κB. MUC2 induced additional DC-conditioning signals via intestinal epithelial cells. Thus, mucus does not merely form a nonspecific physical barrier, but also constraints the immunogenicity of gut antigens by delivering tolerogenic signals.

Cross-linking of high-affinity immunoglobulin E (IgE) results in the life-threatening allergic reaction anaphylaxis. Yet the cellular mechanisms that induce B cells to produce IgE in response to allergens remain poorly understood. T follicular helper (TFH) cells direct the affinity and isotype of antibodies produced by B cells. Although TFH cell–derived interleukin-4 (IL-4) is necessary for IgE production, it is not sufficient. We report a rare population of IL-13–producing TFH cells present in mice and humans with IgE to allergens, but not when allergen-specific IgE was absent or only low-affinity. These “TFH13” cells have an unusual cytokine profile (IL-13hiIL-4hiIL-5hiIL-21lo) and coexpress the transcription factors BCL6 and GATA3. TFH13 cells are required for production of high- but not low-affinity IgE and subsequent allergen-induced anaphylaxis. Blocking TFH13 cells may represent an alternative therapeutic target to ameliorate anaphylaxis.

Peanut EPIT administration was safe and associated with a modest treatment response after 52 weeks, with the highest responses among younger children. This, when coupled with a high adherence and retention rate and significant changes in immune pathways, supports further investigation of this novel therapy.

Cells were seeded in 24-well plates and stimulated with CPE or soy extract. Cells were recovered at several time points for RNA isolation with the RNeasy Mini Kit (Qiagen).Bone marrow-derived DCs. Bone marrow cells were collected from femurs and cultured for 10 days in RPMI 1640 with l-glutamine (Gibco, Life Technologies), supplemented with 10% fetal bovine serum (Gemini Bio-products), penicillin/streptomycin (Gibco, Life Technologies), 50 μM 2-Mercaptoethanol (Sigma-Aldrich), and 20 ng/ml GM-CSF (Peprotech). At day 10, bone marrow-derived DCs were collected and resuspended in complete RPMI at a concentration of 5 × 10 5 cells per ml. Cells were stimulated for 3 hours with CPE (50 μg/ml), followed by RNA isolation with the RNeasy Mini Kit (Qiagen).Real-time PCR. RT-PCR was performed, starting from 1 μg total RNA, using SuperScript II Reverse Transcriptase (Invitrogen, Life Technologies). cDNA was amplified using the Power SYBR Green PCR Master Mix (Applied Biosystems, Life Technologies) and run on an Applied Biosystems 7300 Real-Time Detection System, using the following primers: mouse Il6, F, TTCCATCCAGTTGCCTTCTTG; R, GGGAGTGGTATCCTCTGTGAAGTC; mouse Il1b (65), F, TTGACGGACCCCAAAAGAT; R, GAGCGCTCACGAACAGTTG; mouse Il10 (25), F, TGCTATGCTGCCTGCTCTTA; R, TCATTTC-CGATAAGGCTTGG; mouse Ox40l (25), F, CCCTCCAATCCAAA-GACTCA; R, ATCCTTCGACCATCGTTCAG; mouse Il33, F, ATC-GGGTACCAAGCATGAAG; R, GACTTGCAGGACAGGGAGAC; mouse Tslp (48), F, GAGAGAAATGACGGTACTCA; R, CTACAGT-TAGGTTTGCCCTA; mouse Il25, F, TGTTGCATTCTTGGCAAT-GATC; R, GACTGCAGCCCTCCTGGAT; human IL6, F, AAA-GAGGCACTGGCAGAAAA; R, CAGGGGTGGTTATTGCATCT; human IL33, F, GAGCTAAGGCCACTGAGGAA; R, TGGGCCTTT-GAAGTTCCATA.GADPH and β-actin were used as the housekeeping genes. Relative quantification was performed using the comparative threshold cycle method (2 -ΔΔCt ). The changes in gene expression were calculated with respect to the untreated cells. All amplifications were carried out in duplicates. Antigen presentation assay. Antigen presentation assay was performed as previously described (19). BALB/c mice were exposed to 10 mg OVA in the presence or absence of 1 mg CPE. After 24 hours, DCs were purified from inguinal lymph nodes by using CD11c microbeads (Miltenyi Biotec). DCs were cultured at a ratio of 1:5 with DO11.10 CD4 + T cells. After 72 hours, cells were restimulated with anti-CD3/CD28, supernatants were harvested, and cytokines were measured by ELISA according to manufacturer's instructions (all from eBioscience).In neutralization experiments, anti-ST2 was injected prior to exposure with OVA and CPE, as described above. For the OX40L neu- The Journal of Clinical InvestigationR e s e a R c h a R t i c l e 4 9 7 4

These results indicate that triggering of an anaphylactic response requires two phases (1) sensitization by aggregates through Peyer's patches and (2) efficient transfer of soluble protein across the epithelial barrier. As the majority of common food allergens tend to form aggregates, this may be of clinical importance.

Material

Many consider food allergy as the "second wave" of the allergy epidemic following the "first wave" of respiratory allergy, i.e., asthma and allergic rhinitis, plaguing westernized countries, with up to 8% of young children and 2%-3% of adults in the United States now affected by hypersensitivity reactions to various foods. In the past decade, there have been great strides in our understanding of the underlying immunopathogenesis of these disorders, which have led to improved diagnostic techniques, management strategies, and therapeutic approaches. Here we will review the most recent understanding of basic mechanisms underlying IgE-mediated food allergies and novel therapeutic approaches under investigation for both the prevention and treatment of IgE-mediated food allergies.