Skin exposure promotes a Th2-dependent sensitization to peanut allergens

Abstract

Cells were seeded in 24-well plates and stimulated with CPE or soy extract. Cells were recovered at several time points for RNA isolation with the RNeasy Mini Kit (Qiagen).Bone marrow-derived DCs. Bone marrow cells were collected from femurs and cultured for 10 days in RPMI 1640 with l-glutamine (Gibco, Life Technologies), supplemented with 10% fetal bovine serum (Gemini Bio-products), penicillin/streptomycin (Gibco, Life Technologies), 50 μM 2-Mercaptoethanol (Sigma-Aldrich), and 20 ng/ml GM-CSF (Peprotech). At day 10, bone marrow-derived DCs were collected and resuspended in complete RPMI at a concentration of 5 × 10 5 cells per ml. Cells were stimulated for 3 hours with CPE (50 μg/ml), followed by RNA isolation with the RNeasy Mini Kit (Qiagen).Real-time PCR. RT-PCR was performed, starting from 1 μg total RNA, using SuperScript II Reverse Transcriptase (Invitrogen, Life Technologies). cDNA was amplified using the Power SYBR Green PCR Master Mix (Applied Biosystems, Life Technologies) and run on an Applied Biosystems 7300 Real-Time Detection System, using the following primers: mouse Il6, F, TTCCATCCAGTTGCCTTCTTG; R, GGGAGTGGTATCCTCTGTGAAGTC; mouse Il1b (65), F, TTGACGGACCCCAAAAGAT; R, GAGCGCTCACGAACAGTTG; mouse Il10 (25), F, TGCTATGCTGCCTGCTCTTA; R, TCATTTC-CGATAAGGCTTGG; mouse Ox40l (25), F, CCCTCCAATCCAAA-GACTCA; R, ATCCTTCGACCATCGTTCAG; mouse Il33, F, ATC-GGGTACCAAGCATGAAG; R, GACTTGCAGGACAGGGAGAC; mouse Tslp (48), F, GAGAGAAATGACGGTACTCA; R, CTACAGT-TAGGTTTGCCCTA; mouse Il25, F, TGTTGCATTCTTGGCAAT-GATC; R, GACTGCAGCCCTCCTGGAT; human IL6, F, AAA-GAGGCACTGGCAGAAAA; R, CAGGGGTGGTTATTGCATCT; human IL33, F, GAGCTAAGGCCACTGAGGAA; R, TGGGCCTTT-GAAGTTCCATA.GADPH and β-actin were used as the housekeeping genes. Relative quantification was performed using the comparative threshold cycle method (2 -ΔΔCt ). The changes in gene expression were calculated with respect to the untreated cells. All amplifications were carried out in duplicates. Antigen presentation assay. Antigen presentation assay was performed as previously described (19). BALB/c mice were exposed to 10 mg OVA in the presence or absence of 1 mg CPE. After 24 hours, DCs were purified from inguinal lymph nodes by using CD11c microbeads (Miltenyi Biotec). DCs were cultured at a ratio of 1:5 with DO11.10 CD4 + T cells. After 72 hours, cells were restimulated with anti-CD3/CD28, supernatants were harvested, and cytokines were measured by ELISA according to manufacturer's instructions (all from eBioscience).In neutralization experiments, anti-ST2 was injected prior to exposure with OVA and CPE, as described above. For the OX40L neu- The Journal of Clinical InvestigationR e s e a R c h a R t i c l e 4 9 7 4

Peanut lipids display potential adjuvanticity by triggering a pro‐inflammatory response in human keratinocytes

“…Our findings are in line with previous studies demonstrating that the matrix from allergen sources contains compounds that might aid allergic sensitization and lipids may play a fundamental role 1, 2, 3. The pro‐inflammatory mediators produced by KC upon PNL stimulation may perhaps lead to barrier disruption and promote the proper environment allowing Ara h 1 or Ara h 2 to penetrate the epidermis and recruit neighboring cells involved in the allergic sensitization process 6.…”

“…Exposure of infants to peanut oil‐containing lotions was described as a risk factor for the development of peanut allergy 1. There is evidence that only peanut extracts containing lipids were able to induce sensitization 2, 3. How this occurs at the molecular level is still unknown.…”

“…If crude peanut extract containing both allergens and lipids, but not purified peanut allergens alone, can sensitize mice via intact skin,1, 3 we wondered whether this effect might be due to the presence of peanut lipids (PNL). Therefore, we hypothesized that PNL might represent an adjuvant for peanut allergens in sensitization via the skin.…”

“…Such mediators were shown to cause barrier disruption, facilitate allergen penetration and initiate cutaneous inflammation 5, 6. Interestingly, allergens coadministered with PNL were not able to modify (neither inhibit nor synergize) this effect of PNL, suggesting that the capacity of PNL to activate the innate immune system is maintained in the presence of the allergens, as in crude peanut extract 2, 3. In contrast, peanut allergens coadministered with PNL inhibited the production of PNL‐induced IL‐10, likely produced by KC as a compensatory mechanism.…”

Cutaneous exposure to clinically-relevant pigeon pea (Cajanus cajan) proteins promote TH2-dependent sensitization and IgE-mediated anaphylaxis in Balb/c mice

“…In previous studies, it was demonstrated that skin exposure to peanut and OVA allergen is an effective route for inducing sensitization (Hsieh et al 2003;Tordesillas et al 2014). Building on those studies, the present study also indicated that there was a sensitizing ability for pigeon pea allergens via the skin route.…”