Plants are known to harbor endophytic bacteria, the organisms residing internally without imparting any apparent adverse effects on the host. Endophytes are generally known to be present in few numbers colonizing the intercellular spaces, primarily in roots. This study adopting SYTO 9 staining and live confocal imaging of fresh tissue sections from the shoot-tip region of banana, supported by transmission electron microscopy, brings out, possibly for the first time, extensive bacterial colonization in the confined cell wall – plasma membrane peri-space. The integral host-association and their abundance suggest a prominent role of endophytes in the biology of the host.
Coconut palm (Cocos nucifera L.), a versatile tree crop with multifarious uses, is important for the livelihood security of millions of people in India. Root (wilt) disease (RWD) is a major production constraint causing an estimated yield loss of 968 million nuts in southern India. Affected palms show bending of leaflets (flaccidity), foliar yellowing, and marginal necrosis. Phytoplasmas have been observed to be associated with this disease by electron microscopy (EM) and transmission (3) but not characterized. Attempts made in the past decade to detect a phytoplasma associated with RWD through PCR using universal primers had inconsistent results so we designed two primer sets (1F7 [AGTGCTTAACACTGTCCTGCTA]/7R3 [TTGTAGCCCAGATCATAAGGGGCA], 3Fwd [ACCTGCCTTTAAGACGAGGA]/3Rev [AAAGGAGGTGATCCATCCCCACCT]) and seminested primer pair 1F7/7R2 (GACAAGGGTTGCGCTCGTTTT), 3Fwd/5Rev (ACCCCGAGAACGTATTCACCGCGA) from sequencing of a 1.8-kb fragment (GenBank No. FJ794816) amplified by primers P1/P7 from a diseased sample. These new primer pairs were used for the detection of phytoplasma from five symptomatic and five asymptomatic palms from Kasaragod (where disease is not endemic), 14 symptomatic palms from Kayamkulam (endemic area), and 10 palms from disease-free areas (Kidu, Karnataka) using PCR. DNA was extracted from 3 g of spindle leaf (two to three leaflets) midrib tissues using a modified phytoplasma enrichment protocol in which an addition of 5% polyvinylpolypyrrolidone (MW of 40,000) during tissue grinding was essential. PCR was performed for 35 cycles with an annealing temperature of 63°C to avoid nonspecific amplification. A 1.3-kb amplicon was seen in two of the five samples and the positive control sample (sugarcane grassy shoot DNA) using the seminested primer pair 3Fwd/3Rev–3Fwd/5Rev. The amplicons were cloned and sequenced and a representative sequence was deposited in GenBank (GQ850122). With the 1F7/7R3-1F7/7R2 seminested primers, a 493-bp product was obtained from 13 of 14 palms from Kayamkulam and all five diseased palms from Kasaragod. No amplification was seen from healthy palms. A BLAST search showed that the RWD phytoplasma 16S rRNA gene sequence has >96% nt identity with 16SrXI and 16SrXIV group phytoplasmas and 99% identity with sugarcane white leaf phytoplasma (AB052874), On the basis of the identity of the 16Sr RNA gene 3Fwd/5Rev region, RWD phytoplasma belongs to the 16SrXI group. A phylogenetic tree (neighbor-joining method) also revealed clustering of the coconut phytoplasma with the 16SrXI group phytoplasmas and virtual restriction fragment length polymorphism analysis (4) also placed it into group 16SrXI. Other phytoplasmas infecting coconut are found in groups 16SrIV (1) and 16SrXIV (2). Our RWD phytoplasma sequence does not match an earlier reported Kerala (wilt) coconut phytoplasma sequence (AY158660) and the latter sequence does not have similarity with any known phytoplasma sequences in the database. To our knowledge, this is first report of the association of 16SrXI group phytoplasma with the root wilt disease of coconut in India. These findings could be used for the early detection of root wilt disease phytoplasma in breeding materials and to develop a DNA-based diagnostic kit. References: (1) N. A. Harrison et al. Ann. Appl. Biol. 153:85, 2008. (2) N. Nejat et al. Am. J. Appl. Sci. 6:1331, 2009. (3) M. Sasikala et al. Eur. J. Plant Pathol. 94:191, 2005. (4) Y. Zhao et al. Int. J. Syst. Evol. Microbiol. 59:2582, 2007.
Twenty-four isolates of Chilli veinal mottle virus (ChiVMV) from China, India, Indonesia, Taiwan and Thailand were analysed to determine their genetic relatedness. Pathogenicity of virus isolates was confirmed by induction of systemic mosaic and/or necrotic ringspot symptoms on Capsicum annuum after mechanical inoculation. The 3 ′ terminal sequences of the viral genomic RNA were determined. The coat protein (CP) coding regions ranged from 858 to 864 nucleotides and the 3 ′ untranslated regions (3 ′ UTR) from 275 to 289 nucleotides in length. All isolates had the inverted repeat sequence GUGGNNNCCAC in the 3 ′ UTR. The DAG motif, conserved in aphid-transmitted potyviruses, was observed in all isolates. All 24 isolates were considered as belonging to ChiVMV because of their high CP amino acid and nucleotide identity (more than 94·8 and 89·5%, respectively) with the reported ChiVMV isolates including the pepper vein banding virus (PVBV), the chilli vein-banding mottle virus (CVbMV) and the CVbMV Chiengmai isolate (CVbMV-CM1). Based on phylogenetic analysis, ChiVMV isolates including all 24 isolates tested, PVBV, CVbMV and CVbMV-CM1 can be classified into three groups. In addition, a conserved region of 204 amino acids with more than 90·2% identity was identified in the C terminal of the CP gene of ChiVMV and Pepper veinal mottle virus (PVMV), and may explain the serological cross reaction between these two viruses. The conserved region may also provide useful information for developing transgenic resistance to both ChiVMV and PVMV.
In Bangladesh little leaf disease was observed in brinjal (Solanum melongena L.) and in periwinkle (Catharanthus roseus). Phloem‐inhabiting phytoplasmas were consistently detected in both species of diseased plants using transmission electron microscopy (TEM) and polymerase chain reaction (PCR) techniques. The shape, size and within‐tissue distribution of phytoplasmas appears to be similar in both hosts. Furthermore, the molecular characterization and identifications of observed phytoplasmas were carried out based on restriction fragment length polymorphism (RFLP) patterns of PCR‐amplified products (1200 bp) using phytoplasma‐specific universal primers and sequencing analysis of both 16S ribosomal DNA (rDNA) and intergenic spacer region (ISR) of 16S‐23S rDNA phytoplasma genes. The patterns of RFLP analysis with seven restriction enzymes exhibited a similar pattern for both phytoplasma strains. The sequence homology between these two strains showed 100% similarity based on 16S rDNA and 16S‐23S ISR. Therefore, in Bangladesh the causal agents of brinjal little leaf (BLL‐Bd) and periwinkle little leaf (PLL‐Bd) are probably the same or closely related phytoplasma strains. These strains, are very close or identical to the strain of brinjal little leaf phytoplasma in India (BLL‐In), belonging to the clover proliferation group (Lee et al., Int. J. Syst. Bacteriol. 48, 1153–1169, 1998; Seemuller et al., J. Plant Pathol. 80, 3–26, 1998).
Bacterial wilt (causal organism-Ralstonia solanacearum) is one of the most important soil-borne diseases of eggplant (Solanum melongena) worldwide. The best way to control it economically is to develop cultivars resistant to this soil-borne pathogen. Resistance gene (R-gene) cloning and sequencing to obtain resistance gene analogs (RGAs) is one of the most recent approaches for obtaining disease resistant cultivars. Three different types of degenerative PCR based primers were used for isolating RGAs from resistant cultivated/ wild species through amplification of the target region of nucleotide binding site-leucine rich repeat (NBS-LRR). Genetic diversity was observed in the sequences isolated, and six sequences showing specific conserved motifs were shortlisted as Solanum melongena RGAs (Sm7RGA1, Sm7RGA2, Sm7RGA4, Sm7RGA8 and Sm7RGA10) and Solanum viarum RGA (SvRGA2). The RGAs isolated in this study belong to both toll interleukin-1 receptors (TIR)-NBS-LRR and non-TIR-NBS-LRR type R-genes and show similarity with other plant resistance genes. This study also confirmed the hypothesis that dicots have both TIR and non-TIR resistance genes. The present study on eggplant RGAs will help develop RGA based markers linked to bacterial wilt in eggplant and other plant species. Further, it will provide information and pave the way for elucidation at the molecular level of wild and cultivated species' mechanism of resistance to bacterial wilt. This is the first report of NBS-LRR class resistance genes/RGA in resistant eggplant and its wild relatives against bacterial wilt (BW).
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.