The association between humoral immunity to unique and conserved epitopes of the Chlamydia trachomatis 60-kDa heat-shock protein (hsp60) and immunity to human hsp60 was examined in 129 women with laparoscopically verified pelvic inflammatory disease. An ELISA was used to detect antichlamydial IgG and IgA antibodies, IgG antibodies to recombinant human hsp60, and antibodies to two synthetic peptides of chlamydial hsp60. Half of the patients had antibodies to human hsp60, which correlated with the presence of antibodies to the chlamydial hsp60 peptide 260-271 homologous to the human hsp60 (P = .01). Antibodies to peptide 260-271 were associated with antichlamydial IgG (P < .0001) and IgA (P < .0001). The results suggest that the autoimmune response to human hsp60 can develop following C. trachomatis upper genital tract infection in women, probably as a consequence of an immune response to an epitope of chlamydial hsp60 cross-reactive with the human hsp60.
The immunostimulatory effects of oligodeoxyribonucleotides (ODN) containing unmethylated CpG dinucleotides (CpG-ODN) in certain base contexts have been extensively studied in man and mice. One major action is their ability to trigger production of massive amounts of interferon-alpha (IFN-alpha) by plasmacytoid dendritic cells (PDC), also referred to as natural IFN-alpha/beta producing cells (NIPC). The present study using porcine PBMC activated by CpG-ODN or plasmid DNA revealed a considerable variation in the IFN-alpha production in response to various CpG-ODN constructs. Several phosphodiester ODNs, such as 5' TTTTCAATTCGAAGATGAAT 3' (ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-alpha. Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-alpha induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-alpha without pre-incubation with lipofectin, for instance the ODN 2216 (5' GGGGGACGATCGTCGGGGGG 3'). While poly-G sequences have been suggested to increase uptake of ODNs by cells, they did not obviate the need for lipofectin when added to the ODN H. However, they resulted in up to five-fold increases of the IFN-alpha levels caused by ODN H upon lipofection, indicating other enhancing effects of poly-G sequences on the induction of IFN-alpha. The identity of the IFN-alpha producing cells (IPC) stimulated by CpG-ODN or plasmid DNA was studied by means of flow cytometry using combined staining for intracellular IFN-alpha and surface markers. Approximately 1-3 IPC/10(3) PBMC were detected, compared to only 3 IPC/10(4) PBMC stimulated by Aujeszky's disease virus. The IPC frequencies were confirmed by detection of IFN-alpha mRNA positive cells by in situ hybridisation. The IPC induced by CpG-ODN or plasmid DNA had a similar phenotype, expressing CD2 and CD4 and intermediate levels of MHC class II and the myeloid marker SWC3, but not the markers of T and B cells or monocytes (CD3, CD21 and CD14). Consequently, porcine IPC that respond to CpG-DNA seem to correspond to the PDC/NIPC.
Sera from patients with sexually acquired reactive arthritis (SARA) with antibodies reacting with C. trachomatis and C. pneumoniae (group 1; n = 20) and also with C. psittaci (group 2; n = 19) were analyzed for antibody specificity. Sera from group 2 reacted significantly more often with C. trachomatis serotype E, H and K and had higher antibody titers to serotype E, as tested by microimmunofluorescence tests. Cross-reactivities occurring in microimmunofluorescence tests were related to the presence of antichlamydial lipopolysaccharide antibodies, adsorption of which by recombinant lipopolysaccharide removed microimmunofluorescence reactivity with C. psittaci antigen. In group 2, significantly more sera had antibodies to C. pneumoniae, remaining after lipopolysaccharide adsorption, as proved by adsorption with viable C. trachomatis and C. pneumoniae organisms. None of the sera had antibodies to Yersinia enterocolitica, Shigella flexneri, Sh. sonnei and Salmonella spp. It was observed that the frequency and titer of cross-reacting antibodies to chlamydial serotypes and species were related to the time period between the diagnosis of genital chlamydial infection and of SARA. Cross-reactivities were also related to the presence of lipopolysaccharide, but not heat shock protein 60- or neutralizing antibodies to chlamydiae. Antibody reactivity induced by antichlamydial lipopolysaccharide antibodies can be removed by lipopolysaccharide adsorption.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.