Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-α in the pig and the phenotype of the IFN-α producing cells

Abstract

The immunostimulatory effects of oligodeoxyribonucleotides (ODN) containing unmethylated CpG dinucleotides (CpG-ODN) in certain base contexts have been extensively studied in man and mice. One major action is their ability to trigger production of massive amounts of interferon-alpha (IFN-alpha) by plasmacytoid dendritic cells (PDC), also referred to as natural IFN-alpha/beta producing cells (NIPC). The present study using porcine PBMC activated by CpG-ODN or plasmid DNA revealed a considerable variation in the IFN-alpha production in response to various CpG-ODN constructs. Several phosphodiester ODNs, such as 5' TTTTCAATTCGAAGATGAAT 3' (ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-alpha. Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-alpha induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-alpha without pre-incubation with lipofectin, for instance the ODN 2216 (5' GGGGGACGATCGTCGGGGGG 3'). While poly-G sequences have been suggested to increase uptake of ODNs by cells, they did not obviate the need for lipofectin when added to the ODN H. However, they resulted in up to five-fold increases of the IFN-alpha levels caused by ODN H upon lipofection, indicating other enhancing effects of poly-G sequences on the induction of IFN-alpha. The identity of the IFN-alpha producing cells (IPC) stimulated by CpG-ODN or plasmid DNA was studied by means of flow cytometry using combined staining for intracellular IFN-alpha and surface markers. Approximately 1-3 IPC/10(3) PBMC were detected, compared to only 3 IPC/10(4) PBMC stimulated by Aujeszky's disease virus. The IPC frequencies were confirmed by detection of IFN-alpha mRNA positive cells by in situ hybridisation. The IPC induced by CpG-ODN or plasmid DNA had a similar phenotype, expressing CD2 and CD4 and intermediate levels of MHC class II and the myeloid marker SWC3, but not the markers of T and B cells or monocytes (CD3, CD21 and CD14). Consequently, porcine IPC that respond to CpG-DNA seem to correspond to the PDC/NIPC.

Structure-Dependent Modulation of Alpha Interferon Production by Porcine Circovirus 2 Oligodeoxyribonucleotide and CpG DNAs in Porcine Peripheral Blood Mononuclear Cells

“…Cultures of poPBMCs (200 l) were established in microtiter plates (Nunc; Roskilde, Denmark) at a final concentration of 5 ϫ 10 6 cells/ml in the presence of specific ODN preparations, control plasmid DNA, or virus preparations at concentrations previously determined as optimal for IFN-␣ induction (11,19). Cell culture supernatants were collected after 20 h of incubation at 37°C, 7% CO 2 , and stored at Ϫ20°C until further use.…”

“…It is still unknown how PCV2 becomes activated, but in clinically diseased pigs, such as those presenting with the PCV2-associated disease postweaning multisystemic wasting syndrome, a number of organs, including the liver, lungs, and kidneys, are affected, and an abundance of the PCV2 antigen can be detected in the lesions (2). In vitro studies have confirmed that PCV2 can persist in porcine myeloid DCs and porcine plasmacytoid DCs (PDCs), also referred to as natural interferon-producing cells (NIPCs) (11,43), with no effect on their viability or expression of differentiation antigens. However, the ability of PDCs to produce the cytokines alpha interferon (IFN-␣) and tumor necrosis factor alpha is clearly diminished in the presence of PCV2 (46).…”

“…In vitro studies have shown that many phosphodiester ODNs require pretreatment with a transfecting agent such as Lipofectin to induce IFN-␣ production in human and porcine cells (11,33). One such phosphodiester ODN (ODN H) (42) con-tains the central hexamer TTCGAA, analogous to a DNA sequence found in the blood of a patient presenting with the autoimmune disease systemic lupus erythematosus (42).…”

“…One such phosphodiester ODN (ODN H) (42) con-tains the central hexamer TTCGAA, analogous to a DNA sequence found in the blood of a patient presenting with the autoimmune disease systemic lupus erythematosus (42). Modifications such as the addition of poly(G) sequences and/or double-stranded conformation of ODN H have been demonstrated to increase the IFN-␣-inducing capacity elicited by ODN H, but the requirement for pretreatment with Lipofectin still remains a prerequisite for any observed IFN-␣ induction (11). These results are in agreement with studies using human peripheral blood mononuclear cells (PBMCs), which have shown that the secondary structure can be crucial for the cytokine induction and/or B-cell proliferation elicited by specific ODNs (9,24).…”

“…Specifically, derivatives of the previously characterized stimulatory (ODN H) (11) and inhibitory (ODN PCV2/1) (19) ODNs were used. The inhibition of IFN-␣ production was assayed in cultures of poPBMCs induced by other heterologous and reference ODNs, using viral and bacterial inducers as controls.…”