The DNA vaccine vector pcDNA3 induces IFN-α production in pigs

Johansson, Elin; Wallgren, Per; Fuxler, Lisbeth; Domeika, K; Lefèvre, François; Fossum, Caroline

doi:10.1016/s0165-2427(02)00024-7

Cited by 12 publications

(11 citation statements)

References 46 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The present study shows that DNA in the form of ODNs containing unmethylated CpG is a potent inducer of IFN-a in porcine leukocytes, which confirm our earlier findings using plasmid DNA (Johansson et al, 2002;Magnusson et al, 2001a). Double labelling for intracellular IFN-a and various cell surface markers showed that the porcine IPC activated by immunostimulatory DNA exhibit many similarities to the human NIPC/PDC.…”

Section: Discussionsupporting

confidence: 91%

“…In the pig, only a limited number of studies on CpG-DNA have been conducted using either oligodeoxyribonucleotides (ODN) that contain unmethylated CpG-dinucleotides (CpG-ODN) or plasmid DNA. It was found that the plasmid pcDNA3 induced IFN-a in porcine PBMC (poPBMC) in vitro, when pre-incubated with lipofectin (Magnusson et al, 2001a), and also when administered in vivo into subcutaneous tissue chambers (Johansson et al, 2002). Methylation of the cytosine in the CpGs inhibited the IFN-a inducing capacity of plasmid DNA in vitro (Magnusson et al, 2001a) and in vivo (Johansson et al, 2002).…”

Section: Introductionmentioning

confidence: 99%

“…It was found that the plasmid pcDNA3 induced IFN-a in porcine PBMC (poPBMC) in vitro, when pre-incubated with lipofectin (Magnusson et al, 2001a), and also when administered in vivo into subcutaneous tissue chambers (Johansson et al, 2002). Methylation of the cytosine in the CpGs inhibited the IFN-a inducing capacity of plasmid DNA in vitro (Magnusson et al, 2001a) and in vivo (Johansson et al, 2002). Other in vitro studies using ODN showed that the ability to induce IL-6, IL-12 and TNF-a mRNA in poPBMC was dependent on the presence of CpG (Kamstrup et al, 2001).…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-α in the pig and the phenotype of the IFN-α producing cells

Domeika

Magnusson

Eloranta

et al. 2004

Veterinary Immunology and Immunopathology

View full text Add to dashboard Cite

The immunostimulatory effects of oligodeoxyribonucleotides (ODN) containing unmethylated CpG dinucleotides (CpG-ODN) in certain base contexts have been extensively studied in man and mice. One major action is their ability to trigger production of massive amounts of interferon-alpha (IFN-alpha) by plasmacytoid dendritic cells (PDC), also referred to as natural IFN-alpha/beta producing cells (NIPC). The present study using porcine PBMC activated by CpG-ODN or plasmid DNA revealed a considerable variation in the IFN-alpha production in response to various CpG-ODN constructs. Several phosphodiester ODNs, such as 5' TTTTCAATTCGAAGATGAAT 3' (ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-alpha. Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-alpha induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-alpha without pre-incubation with lipofectin, for instance the ODN 2216 (5' GGGGGACGATCGTCGGGGGG 3'). While poly-G sequences have been suggested to increase uptake of ODNs by cells, they did not obviate the need for lipofectin when added to the ODN H. However, they resulted in up to five-fold increases of the IFN-alpha levels caused by ODN H upon lipofection, indicating other enhancing effects of poly-G sequences on the induction of IFN-alpha. The identity of the IFN-alpha producing cells (IPC) stimulated by CpG-ODN or plasmid DNA was studied by means of flow cytometry using combined staining for intracellular IFN-alpha and surface markers. Approximately 1-3 IPC/10(3) PBMC were detected, compared to only 3 IPC/10(4) PBMC stimulated by Aujeszky's disease virus. The IPC frequencies were confirmed by detection of IFN-alpha mRNA positive cells by in situ hybridisation. The IPC induced by CpG-ODN or plasmid DNA had a similar phenotype, expressing CD2 and CD4 and intermediate levels of MHC class II and the myeloid marker SWC3, but not the markers of T and B cells or monocytes (CD3, CD21 and CD14). Consequently, porcine IPC that respond to CpG-DNA seem to correspond to the PDC/NIPC.

show abstract

Section: Discussionsupporting

confidence: 91%

Section: Introductionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-α in the pig and the phenotype of the IFN-α producing cells

Domeika

Magnusson

Eloranta

et al. 2004

Veterinary Immunology and Immunopathology

View full text Add to dashboard Cite

show abstract

“…Also, the empty pcDNA3 plasmid alone had some stimulatory effects on T-cell populations, in agreement with previous work that showed that it could induce cytokine production [37], likely through the adjuvant effect of CpG motifs [38]. However, this did not affect the course of T. cruzi infection, which clearly demonstrates that the therapeutic efficacy of the DNA vaccine is due to an immune response directed to the expressed antigen.…”

Section: Discussionsupporting

confidence: 89%

Control of Trypanosoma cruzi infection and changes in T-cell populations induced by a therapeutic DNA vaccine in mice

et al. 2006

View full text Add to dashboard Cite

“…The growing demand for specific porcine cytokine reagents indicates that many laboratories in different branches of immunology and physiology wish to study cytokine (IFN) responses using the pig as model (Kamstrup et al, 2001;Johansson et al, 2002;Magnusson et al, 2001). The present research on aligning the subtypes of porcine IFN-α, simulating their structures, analyzing their promoters, and identifying the effects of Cterminal deletion, should not only enhance understanding of the function of these versatile molecules in a novel animal model, but also facilitate further research on the role of the porcine IFN system.…”

Section: Discussionmentioning

confidence: 99%