The presence of the father living in the family home acted as a buffer against parents' symptoms.
In late summer 2001, field-grown pepper (Capsicum annuum) plants showing chlorotic blotching in leaves and fruits were observed in Benicarló, Castellón, Spain. Enzyme-linked immunosorbent assays of extracts of these plants with a collection of plant virus antisera showed a positive reaction only with Broad bean wilt virus serotype 1 (BBWV-1) antiserum. To confirm BBWV-1 infection, primers B1 (GCTCTTCCCCATATAACTTTC) and B2 (GTCTCTATCTTCTCTTCTTCC) were designed based on the nucleotide sequence of BBWV-1 isolate PV132 (GenBank Accession No. AB018702), and were used for reverse-transcription polymerase chain reaction analysis. RNAs extracted from symptomatic plants yielded a cDNA product of ~500 bp that was not obtained using RNA extracts from healthy plants. The sequence of this cDNA fragment was determined, and it showed ~80% nucleotide identity with a BBWV-1 genomic region, encompassing part of the two coat proteins genes. Amino acid identities were ~94% with BBWV-1 isolates and ~60% with BBWV-2 isolates. BBWV-1 and BBWV-2 are considered different species of the genus Fabavirus. BBWV-1 and BBWV-2 are distributed worldwide and infect a wide range of plants. In the Mediterranean Basin, BBWV-1 has been serologically identified in Jordan, Lebanon, Syria, Egypt, Tunisia, Morocco (2), and Italy (1), but no nucleotide sequence data is available. To our knowledge, this is the first report of BBWV-1 in Spain. References: (1) M. G. Bellardi et al. Plant Dis. 81:959, 1997. (2) K. M. Makkouk et al. Neth. J. Plant Pathol. 96:291, 1990.
O primeiro caso de COVID-19 foi identificado na China no final de 2019 e rapidamente foi declarada pandemia em consequência da elevada transmissibilidade e morbimortalidade do vírus Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2), seu agente etiológico. O espectro clínico é altamente variável, desde sintomas respiratórios e sistêmicos leves até quadros graves com sepse, síndrome do desconforto respiratório agudo (SDRA) e disfunção de múltiplos órgãos. Postula-se que a desproporcional resposta imune do hospedeiro humano ao vírus seja responsável pelas injúrias teciduais e hiperinflamação sistêmica. Os achados tomográficos principais incluem opacidades em vidro fosco e consolidações periféricas e podem variar ao longo do curso da doença, sendo, portanto, inespecíficos. Exames diagnósticos baseiam-se na detecção de proteínas do vírus e resposta imunológica à inflamação. Agentes antivirais e drogas imunomoduladoras estão sendo testados. Até o momento, o tratamento baseia-se em terapia de suporte, controle de sintomas clínicos e manejo de complicações.
Summary:The efficacy and safety of bevantolol (new cardioselective beta-blocking agent without intrinsic sympathetic activity) were evaluated in chronic stable angina pectoris. Acute effects on heart rate (HR) and pulmonary function (forced expiratory volume in the first second, FEV,, and vital capacity, VC) (doubleblind placebo, propranolol, 80 mg, and bevantolol, 150 mg) and the antianginal efficacy during early (doubleblind placebo period) and chronic bevantolol therapy (long-term follow-up for 52 weeks) were studied. Bevantolol reduces HR in the same way as propranolol (both p
Background. COVID-19 is associated with a prothrombotic state leading to adverse clinical outcomes. Whether therapeutic anticoagulation improves outcomes in patients hospitalised with COVID-19 is unknown. We aimed to compare the efficacy and safety of therapeutic versus prophylactic anticoagulation in this population. Methods. We did a pragmatic, open-label (with blinded adjudication), multicentre, randomised, controlled trial, at 31 sites in Brazil. Patients (aged ≥18 years) hospitalised with COVID-19 and elevated D-dimer concentration, and who had COVID-19 symptoms for up to 14 days before randomisation, were randomly assigned (1:1) to receive either therapeutic or prophylactic anticoagulation. Therapeutic anticoagulation was in-hospital oral rivaroxaban (20 mg or 15 mg daily) for stable patients, or initial subcutaneous enoxaparin (1 mg/kg twice per day) or intravenous unfractionated heparin (to achieve a 0·3–0·7 IU/mL anti-Xa concentration) for clinically unstable patients, followed by rivaroxaban to day 30. Prophylactic anticoagulation was standard in-hospital enoxaparin or unfractionated heparin. The primary efficacy outcome was a hierarchical analysis of time to death, duration of hospitalisation, or duration of supplemental oxygen to day 30, analysed with the win ratio method (a ratio >1 reflects a better outcome in the therapeutic anticoagulation group) in the intention-to-treat population. The primary safety outcome was major or clinically relevant non-major bleeding through 30 days. This study is registered with ClinicalTrials.gov (NCT04394377) and is completed. Findings. From June 24, 2020, to Feb 26, 2021, 3331 patients were screened and 615 were randomly allocated (311 [50%] to the therapeutic anticoagulation group and 304 [50%] to the prophylactic anticoagulation group). 576 (94%) were clinically stable and 39 (6%) clinically unstable. One patient, in the therapeutic group, was lost to follow-up because of withdrawal of consent and was not included in the primary analysis. The primary efficacy outcome was not different between patients assigned therapeutic or prophylactic anticoagulation, with 28.899 (34.8%) wins in the therapeutic group and 34.288 (41.3%) in the prophylactic group (win ratio 0.86 [95% CI 0.59–1.22], p=0·40). Consistent results were seen in clinically stable and clinically unstable patients. The primary safety outcome of major or clinically relevant non-major bleeding occurred in 26 (8%) patients assigned therapeutic anticoagulation and seven (2%) assigned prophylactic anticoagulation (relative risk 3.64 [95% CI 1.61–8.27], p=0.0010). Allergic reaction to the study medication occurred in two (1%) patients in the therapeutic anticoagulation group and three (1%) in the prophylactic anticoagulation group. Interpretation. In patients hospitalised with COVID-19 and elevated D-dimer concentration, in-hospital therapeutic anticoagulation with rivaroxaban or enoxaparin followed by rivaroxaban to day 30 did not improve clinical outcomes and increased bleeding compared with prophylactic anticoagulation. Therefore, use of therapeutic-dose rivaroxaban, and other direct oral anticoagulants, should be avoided in these patients in the absence of an evidence-based indication for oral anticoagulation.
Paciente de 79 anos, masculino, com diagnóstico recente de mielofibrose, apresentou tosse persistente por uma semana. Durante investigação diagnóstica, tomografia computadorizada de tórax evidenciou micronódulos de distribuição randômica difusos em ambos os pulmões. Na suspeita de quadro infeccioso, o paciente foi submetido a broncoscopia, cuja biópsia confirmou processo granulomatoso crônico e, no entanto, as pesquisas de fungos e bacilo álcoolresistente foram negativas. O diagnóstico de histoplasmose pulmonar aguda foi firmado após positividade da banda M na sorologia para Histoplasma capsulatum. Iniciado tratamento com itraconazol, paciente evoluiu com completa resolução da doençaos sintomas.
Sarcoidose é uma doença sistêmica que pode acometer vários órgãos. Relatamos o caso de uma paciente com acometimento pulmonar nodular que é uma apresentação rara da sarcoidose pulmonar. Caracteriza-se por sintomas constitucionais associados ao achado de único ou múltiplos nódulos pulmonares. A presença de granulomas geralmente não caseosos na biópsia pulmonar corrobora o diagnóstico, juntamente com a exclusão de outras doenças granulomatosas. O prognóstico costuma ser favorável, com boa resposta ao tratamento com corticosteroide oral.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.