The present study developed a pathovar-specific PCR for the detection of Xanthomonas campestris pv. musacearum (Xcm), the cause of banana xanthomonas wilt, by amplification of a 265-bp region of the gene encoding the general secretion pathway protein D (GspD). A distinct DNA fragment of the expected size was amplified from genomic DNA from all of 12 Xcm isolates tested and no amplification of DNA was observed from other xanthomonads or plant-associated bacteria, including the two closely related species Xanthomonas vasicola pv. holcicola and Xanthomonas axonopodis pv. vasculorum. The Xcm-specific PCR was successfully multiplexed with internal control primers targeting 16S rDNA for application on DNA from bacterial cultures and with primers targeting plant mitochondrial 26S rDNA for application on DNA extracted from plant material. Diagnostic discrimination of healthy and infected plants was subsequently demonstrated in tests on artificially inoculated screenhouse cultivars of banana and field bananas with and without symptoms sampled from different parts of Uganda. This study therefore demonstrated a robust and specific Xcm diagnostic tool with the added advantage of applying internal PCR controls for direct quality assessment of results.
From 2008 to 2010, leaf spot symptoms were observed on tomato (Solanum lycopersicum Mill.) plants growing in the northern, central and southern highland regions of Tanzania. Symptoms were dark, circular to irregular, water-soaked spots surrounded by chlorotic halos. A total of 136 yellow-pigmented, gram-negative bacteria were isolated from 117 symptomatic plants on nutrient agar. Loopfuls from 24-h-old bacterial cultures were suspended in 500 μl of sterile distilled water and 50 μl of the suspensions were printed on strips of 3MM Whatman chromatography paper. Isolates belonging to the genus Xanthomonas were subsequently identified by PCR amplification of a 402-bp fragment of the Xanthan synthesis pathway gene, gumD (primers: X-gumD-fw 5′GGCCGCGAGTTCTACATGTTCAA and X-gumD-rv 5′CACGATGATGCGGATATCCAGCCACAA). Thirty of the 136 isolates reacted positively in gumD PCR. Pathogenicity of the 30 gumD-positive isolates was confirmed by spraying cell suspensions containing 108 CFU/ml (OD600 = 0.01) of each isolate on four 14-day-old tomato seedlings (cv. Tanya) and sweet pepper (Capsicum annuum L.) cv. Early-Calwonder in a growth chamber at 28 ± 2°C and maintained under humid conditions. Plants sprayed with X. euvesicatoria, X. vesicatoria, X. perforans, and X. gardneri (2) strains NCPPB 2968, 422, 4321, and 881, respectively, served as positive controls. Plants sprayed with sterile distilled water alone served as negative control. The 30 tested isolates were pathogenic on tomato and pepper within 7 to 14 days and induced similar symptoms as those observed on tomato field plants and plants sprayed with reference strains of xanthomonads. Symptoms were not observed on negative control plants. Yellow-pigmented colonies were reisolated from symptomatic plants and their identity confirmed with GumD-PCR. Based on partial sequencing of the fyuA gene using primers developed by Young et al. (4), all 30 isolates were subsequently grouped into five clusters of the genus Xanthomonas. With recent taxonomy of Xanthomonas (2,4), four of these clusters displayed more than 99% sequence identity to known species of Xanthomonas: X. arboricola EU498923 (18 isolates); X. perforans EU498944 (6 isolates), X. vesicatoria EU498876 (2 isolates), and X. euvesicatoria EU498912 (1 isolate). The remaining three isolates formed a fifth cluster displaying less than 94% sequence identity to any known sequence of fyuA (93% matching strains: X. axonopodis EU498914; X. melonis EU498918, and X. cucurbitae EU498891). Representative sequences for each of the five clusters of bacterial leaf spot (BLS) strains mentioned have been deposited in GenBank (Nos. JQ418487, JQ418488, JQ418489, JQ418490, and JQ418491, respectively). BLS of tomato plants and its economic impact has been reported in Tanzania (3). Different BLS causal agents have recently been reported from the Southwest Indian Ocean Region (1), however, corresponding information for Tanzania has been lacking. On the basis of fyuA sequences, this study reports four genotypes of BLS causal agents corresponding to known species of Xanthomonas. In addition, Xanthomonas isolates with a fyuA genotype not previously assigned to any known species has been identified as part of the BLS pathosystem in Tanzania. References: (1) A. A. Hamza et al. Plant Dis. 94:993, 2010. (2) B. J. Jones et al. Syst. Appl. Microbiol. 27:755, 2004. (3) K. C. Shenge et al. Afr. J. Biotechnol. 6:15, 2007. (4) J. M. Young et al. Syst. Appl. Microbiol. 31:366, 2008.
The distribution, incidence and severity of maize lethal necrosis (MLN) disease in major maize growing agro-ecological zones (AEZ) of Uganda was determined following field surveys carried out in 16 major maize growing districts from 5 AEZ over three consecutive seasons. A total of 604 maize fields were visited and MLN disease status visually assessed and 3,624 maize leaf samples collected for identification and confirmation of the MLN causal viruses by Double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) and Reverse Transcription Polymerase Chain Reaction (RT-PCR). MLN disease was not widely distributed at an epidemic proportion, with only 36 (5%) of the 604 farms surveyed over three seasons confirmed to have the disease. The MLN incidence and severity was significantly (P < 0.05) higher in the Eastern AEZ during the three seasons. The main MLN-causing viruses detected using DAS-ELISA were Maize chlorotic mottle virus (MCMV) and Sugarcane mosaic virus (SCMV). MCMV was the most prevalent MLN causing virus driving the epidemic in Uganda. The three major districts where MLN disease has been found in all three seasons surveyed are Bulambuli, Tororo and Busia which are hotspots for MLN disease. Strategies to control spread of MLN disease should focus on high risk AEZs and hotspot districts.
Background: Groundnut pre-and post-harvest contamination is commonly caused by fungi from the Genus Aspergillus. Aspergillus flavus is the most important of these fungi. It belongs to section Flavi; a group consisting of aflatoxigenic (A. flavus, A. parasiticus and A. nomius) and non-aflatoxigenic (A. oryzae, A. sojae and A. tamarii) fungi. Aflatoxins are food-borne toxic secondary metabolites of Aspergillus species associated with severe hepatic carcinoma and children stuntedness. Despite the well-known public health significance of aflatoxicosis, there is a paucity of information about the prevalence, genetic diversity and population structure of A. flavus in different groundnut growing agroecological zones of Uganda. This cross-sectional study was therefore conducted to fill this knowledge gap. Results: The overall pre-and post-harvest groundnut contamination rates with A. flavus were 30.0 and 39.2% respectively. Pre-and post-harvest groundnut contamination rates with A. flavus across AEZs were; 2.5 and 50.0%; (West Nile), 55.0 and 35.0% (Lake Kyoga Basin) and 32.5 and 32.5% (Lake Victoria Basin) respectively. There was no significant difference (χ 2 = 2, p = 0.157) in overall pre-and post-harvest groundnut contamination rates with A. flavus and similarly no significant difference (χ 2 = 6, p = 0.199) was observed in the pre-and post-harvest contamination of groundnut with A. flavus across the three AEZs. The LKB had the highest incidence of aflatoxin-producing Aspergillus isolates while WN had no single Aspergillus isolate with aflatoxin-producing potential. Aspergillus isolates from the pre-harvest groundnut samples had insignificantly higher incidence of aflatoxin production (χ 2 = 2.667, p = 0.264) than those from the post-harvest groundnut samples. Overall, A. flavus isolates exhibited moderate level (92%, p = 0.02) of genetic diversity across the three AEZs and low level (8%, p = 0.05) of genetic diversity within the individual AEZs. There was a weak positive correlation (r = 0.1241, p = 0.045) between genetic distance and geographic distance among A. flavus populations in the LKB, suggesting that genetic differentiation in the LKB population might be associated to geographic distance. A very weak positive correlation existed between genetic variation and geographic location in the entire study area (r = 0.01, p = 0.471), LVB farming system (r = 0.0141, p = 0.412) and WN farming system (r = 0.02, p = 0.478). Hierarchical clustering using the unweighted pair group method with arithmetic means (UPGMA) revealed two main clusters of genetically similar A. flavus isolates.
Xanthomonas campestris pv. musacearum (Xcm) causing the banana Xanthomonas wilt (BXW) disease has been the main xanthomonad associated with bananas in East and Central Africa based on phenotypic and biochemical characteristics. However, biochemical methods cannot effectively distinguish between pathogenic and non-pathogenic xanthomonads. In this study, gram-negative and yellow-pigmented mucoid bacteria were isolated from BXW symptomatic and symptomless bananas collected from different parts of Uganda. Biolog, Xcm-specific (GspDm), Xanthomonas vasicola species-specific (NZ085) and Xanthomonas genus-specific (X1623) primers in PCR, and sequencing of ITS region were used to identify and characterize the isolates. Biolog tests revealed several isolates as xanthomonads. The GspDm and NZ085 primers accurately identified three isolates from diseased bananas as Xcm and these were pathogenic when re-inoculated into bananas. DNA from more isolates than those amplified by GspDm and NZ085 primers were amplified by the X1623 primers implying they are xanthomonads, these were however non-pathogenic on bananas. In the 16-23 ITS sequence based phylogeny, the pathogenic bacteria clustered together with the Xcm reference strain, while the non-pathogenic xanthomonads isolated from both BXW symptomatic and symptomless bananas clustered with group I xanthomonads. The findings reveal dynamic Xanthomonas populations in bananas, which can easily be misrepresented by only using phenotyping and biochemical tests. A combination of tools provides the most accurate identity and characterization of these plant associated bacteria. The interactions between the pathogenic and non-pathogenic xanthomonads in bananas may pave way to understanding effect of microbial interactions on BXW disease development and offer clues to biocontrol of Xcm.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.