Five Species of Xanthomonads Associated with Bacterial Leaf Spot Symptoms in Tomato from Tanzania

Abstract

From 2008 to 2010, leaf spot symptoms were observed on tomato (Solanum lycopersicum Mill.) plants growing in the northern, central and southern highland regions of Tanzania. Symptoms were dark, circular to irregular, water-soaked spots surrounded by chlorotic halos. A total of 136 yellow-pigmented, gram-negative bacteria were isolated from 117 symptomatic plants on nutrient agar. Loopfuls from 24-h-old bacterial cultures were suspended in 500 μl of sterile distilled water and 50 μl of the suspensions were printed on strips of 3MM Whatman chromatography paper. Isolates belonging to the genus Xanthomonas were subsequently identified by PCR amplification of a 402-bp fragment of the Xanthan synthesis pathway gene, gumD (primers: X-gumD-fw 5′GGCCGCGAGTTCTACATGTTCAA and X-gumD-rv 5′CACGATGATGCGGATATCCAGCCACAA). Thirty of the 136 isolates reacted positively in gumD PCR. Pathogenicity of the 30 gumD-positive isolates was confirmed by spraying cell suspensions containing 108 CFU/ml (OD600 = 0.01) of each isolate on four 14-day-old tomato seedlings (cv. Tanya) and sweet pepper (Capsicum annuum L.) cv. Early-Calwonder in a growth chamber at 28 ± 2°C and maintained under humid conditions. Plants sprayed with X. euvesicatoria, X. vesicatoria, X. perforans, and X. gardneri (2) strains NCPPB 2968, 422, 4321, and 881, respectively, served as positive controls. Plants sprayed with sterile distilled water alone served as negative control. The 30 tested isolates were pathogenic on tomato and pepper within 7 to 14 days and induced similar symptoms as those observed on tomato field plants and plants sprayed with reference strains of xanthomonads. Symptoms were not observed on negative control plants. Yellow-pigmented colonies were reisolated from symptomatic plants and their identity confirmed with GumD-PCR. Based on partial sequencing of the fyuA gene using primers developed by Young et al. (4), all 30 isolates were subsequently grouped into five clusters of the genus Xanthomonas. With recent taxonomy of Xanthomonas (2,4), four of these clusters displayed more than 99% sequence identity to known species of Xanthomonas: X. arboricola EU498923 (18 isolates); X. perforans EU498944 (6 isolates), X. vesicatoria EU498876 (2 isolates), and X. euvesicatoria EU498912 (1 isolate). The remaining three isolates formed a fifth cluster displaying less than 94% sequence identity to any known sequence of fyuA (93% matching strains: X. axonopodis EU498914; X. melonis EU498918, and X. cucurbitae EU498891). Representative sequences for each of the five clusters of bacterial leaf spot (BLS) strains mentioned have been deposited in GenBank (Nos. JQ418487, JQ418488, JQ418489, JQ418490, and JQ418491, respectively). BLS of tomato plants and its economic impact has been reported in Tanzania (3). Different BLS causal agents have recently been reported from the Southwest Indian Ocean Region (1), however, corresponding information for Tanzania has been lacking. On the basis of fyuA sequences, this study reports four genotypes of BLS causal agents corresponding to known species of Xanthomonas. In addition, Xanthomonas isolates with a fyuA genotype not previously assigned to any known species has been identified as part of the BLS pathosystem in Tanzania. References: (1) A. A. Hamza et al. Plant Dis. 94:993, 2010. (2) B. J. Jones et al. Syst. Appl. Microbiol. 27:755, 2004. (3) K. C. Shenge et al. Afr. J. Biotechnol. 6:15, 2007. (4) J. M. Young et al. Syst. Appl. Microbiol. 31:366, 2008.

Identification of Xanthomonas species associated with bacterial leaf spot of tomato, capsicum and chilli crops in eastern Australia

“…The weakly pathogenic nature of these isolates suggests they may be opportunistic, and X. arboricola isolates of uncertain pathogenicity have been previously observed (Fischer-Le Saux et al 2015). BLS-causing isolates of X. arboricola have also been reported in Korea and Tanzania (Myung et al 2010;Mbega et al 2012). These were not included in this MLSA due to a lack of sequence data.…”

“…A Xanthomonas sp. reported on tomato in Tanzania was genetically distinct from the four commonly reported species based on a phylogeny of fyuA sequence (Mbega et al 2012). Xanthomonas campestris pv.…”

“…that cause BLS in tomato and capsicum crops are reported from several countries (EPPO 2013;Timilsina et al 2015). Strains of Xanthomonas arboricola (Vauterin et al 1995) have been shown to cause BLS on capsicum in Korea and has also been associated with disease outbreaks on tomato in Tanzania (Mbega et al 2012;Myung et al 2010). A Xanthomonas sp.…”

Bacterial spot of tomato and pepper: diverse Xanthomonas species with a wide variety of virulence factors posing a worldwide challenge

“…Molecular characterization has revealed species diversity of bacterial spot xanthomonads in Europe, Asian countries, such as Taiwan and India, and African countries, such as Ethiopia, Nigeria, Tanzania and various islands in the southwest Indian Ocean region (Hamza et al, 2012;Kebede et al, 2014;Mbega et al, 2012;Stoyanova et al, 2014). Although there have been reports of bacterial spot from different parts of the world, in many cases, placement into the actual species has not been determined.…”

Scientific Opinion on the pest categorisation of Xanthomonas campestris pv. vesicatoria (Doidge) Dye

“…X. gardneri is a pathogen mainly affecting tomato and, to a lesser extent, C. annuum. X. perforans has been reported to affect tomato only, except for one recent report in Tanzania mentioning pathogenicity on both tomato and pepper for a set of 18 isolates (Mbega et al, 2012). .…”