Severe acute respiratory syndrome coronavirus (SARS-CoV)-2 is a novel and highly pathogenic coronavirus and is the causative agent of the coronavirus disease 2019 (COVID-19). The high morbidity and mortality associated with COVID-19 and the lack of an approved drug or vaccine for SARS-CoV-2 underscores the urgent need for developing effective antiviral therapies. Therapeutics that target essential viral proteins are effective at controlling virus replication and spread. Coronavirus Spike glycoproteins mediate viral entry and fusion with the host cell, and thus are essential for viral replication. To enter host cells, the Spike proteins of SARS-CoV-2 and related coronavirus, SARS-CoV, bind the host angiotensin-converting enzyme 2 (ACE2) receptor through their receptor binding domains (RBDs). Here, we rationally designed a panel of ACE2-derived peptides based on the RBD-ACE2 binding interfaces of SARS-CoV-2 and SARS-CoV. Using SARS-CoV-2 and SARS-CoV Spike-pseudotyped viruses, we found that a subset of peptides inhibits Spike-mediated infection with IC 50 values in the low millimolar range. We identified two peptides that bound Spike RBD in affinity precipitation assays and inhibited infection with genuine SARS-CoV-2. Moreover, these peptides inhibited the replication of a common cold causing coronavirus, which also uses ACE2 as its entry receptor. Results from the infection experiments and modeling of the peptides with Spike RBD identified a 6-amino-acid (Glu37-Gln42) ACE2 motif that is important for SARS-CoV-2 inhibition. Our work demonstrates the feasibility of inhibiting SARS-CoV-2 with peptide-based inhibitors. These findings will allow for the successful development of engineered peptides and peptidomimetic-based compounds for the treatment of COVID-19.

ObjectiveReview the effect of orthostatic hypotension (OH) and rapid-eye-movement sleep behavioural disorder (RBD) on survival, cognitive impairment and postural stability, and discuss pathogenic mechanisms involved in the association of these two common non-motor features with relevant clinical outcomes in α-synucleinopathies.MethodsWe searched PubMed (January 2007–February 2019) for human studies of OH and RBD evaluating cognitive impairment, postural instability, and survival in Parkinson’s disease (PD), dementia with Lewy bodies (DLB), multiple system atrophy (MSA) and pure autonomic failure (PAF). Included studies were analysed for design, key results and limitations as per the Preferred Reporting Items for Systematic Reviews and Meta-Analyses guidelines.ResultsOH and RBD showed a positive association with cognitive impairment in PD and DLB, conflicting association in PAF, and no association in MSA. OH was correlated with incident falls and postural instability in PD and DLB but not in MSA. The association between RBD and postural instability was inconclusive; positive in five studies, negative in seven. OH, but not RBD, correlated with reduced survival in PD, DLB and MSA. The combination of OH and RBD was associated with cognitive impairment and more rapid progression of postural instability.ConclusionsOH and RBD yielded individual and combined negative effects on disability in α-synucleinopathies, reflecting a ‘malignant’ phenotype of PD with early cognitive impairment and postural instability. Underlying mechanisms may include involvement of selected brainstem cholinergic and noradrenergic nuclei.

SUMMARY Follicular helper T cells (T FH ) are critical for vaccine and infection elicitation of long-lived humoral immunity, but exaggerated T FH responses can promote autoimmunity and other pathologies. It is unfortunate that no clinical interventions exist for the selective depletion of follicular T cells to alleviate these diseases. We engineered a chimeric antigen receptor (CAR) facilitating the specific targeting of cells with high expression levels of human programmed cell death protein 1 (PD-1), a cardinal feature of follicular T cells. CAR-expressing human natural killer (NK) cells robustly and discriminately eliminated PD-1 high follicular human T cells in vitro and in a humanized mouse model of lupus-like disease while sparing B cells and other PD-1 low T cell subsets, including regulatory T cells. These results establish a strategy for specific targeting of PD-1 high T cells that can be advanced as a clinical tool for the selective depletion of pathogenic follicular T cells or other PD-1 high target cells in certain disease states.

No abstract

Natural killer (NK) cell suppression of T cells is a key determinant of viral pathogenesis and vaccine efficacy. This process involves perforin-dependent elimination of activated CD4 T cells during the first three days of infection. Although this mechanism requires cell-cell contact, NK cells and T cells typically reside in different compartments of lymphoid tissues at steady state. Here, we show that NK-cell suppression of T cells is associated with a transient accumulation of NK cells within T cell-rich sites of the spleen during lymphocytic choriomeningitis virus infection. The chemokine receptor CXCR3 is required for relocation to T-cell zones and suppression of antiviral T cells. Accordingly, this NK-cell migration is mediated by type I interferon (IFN)-dependent promotion of CXCR3 ligand expression. In contrast, adenoviral vectors that weakly induce type I IFN and do not stimulate NK-cell inhibition of T cells also do not promote measurable redistribution of NK cells to T-cell zones. Provision of supplemental IFN could rescue NK-cell migration during adenoviral vector immunization. Thus, type I IFN and CXCR3 are critical for properly positioning NK cells to constrain antiviral T-cell responses. Development of strategies to curtail migration of NK cells between lymphoid compartments may enhance vaccine-elicited immune responses.

Natural killer (NK) cell suppression of T cells is a key determinant of viral pathogenesis and vaccine efficacy. This process involves perforin-dependent elimination of activated CD4 T cells during the first three days of infection. Although this mechanism requires cell-cell contact, NK cells and T cells typically reside in different compartments of lymphoid tissues at steady state.Here, we showed that NK-cell suppression of T cells is associated with transient accumulation of NK cells within T cell-rich sites of the spleen during lymphocytic choriomeningitis virus infection. The chemokine receptor CXCR3 was required for this relocation and suppression of antiviral T cells. Accordingly, NK-cell migration was mediated by type I interferon (IFN)dependent promotion of CXCR3 ligand expression. In contrast, adenoviral vectors that weakly induced type I IFN and did not stimulate NK-cell inhibition of T cells also did not promote measurable redistribution of NK cells to T-cell zones. Exogenous IFN rescued NK-cell migration during adenoviral vector immunization. Thus, type I IFN and CXCR3 were critical for properly positioning NK cells to constrain antiviral T-cell responses. Development of strategies to curtail migration of NK cells between lymphoid compartments may enhance vaccine-elicited immune responses.

No abstract

35Ddx3x encodes a DEAD box RNA helicase implicated in antiviral immunity and tumorigenesis. 36We find that hematopoietic Ddx3x deficiency in Vav1-Cre mice (Ddx3x) results in altered 37 leukocyte composition of secondary lymphoid tissues, including a marked reduction in mature B 38 cells. This paucity of peripheral B cells is associated with deficits in B-cell development in the 39 bone marrow, including reduced frequencies of small pre-B cells. Bone marrow chimera 40 experiments reveal a B-cell intrinsic effect of Ddx3x deletion. Mechanistically, Ddx3x small pre-41 B cells exhibit lower expression of Brwd1, a histone reader that restricts recombination at the 42 immunoglobulin kappa (Igk) locus. In fact, the B-cell deficits in Ddx3x mice resemble those of 43 Brwd1 mutant mice, and both strains of mice exhibit defective Igk rearrangement in small pre-B 44 cells. The contribution of Ddx3x to Brwd1 expression and light chain rearrangement constitutes 45 the first evidence of a role for an RNA helicase in promoting B-cell development. 46 R software (64bit, v3.2.2). Genome data have been deposited in GEO 113 (https://www.ncbi.nlm.nih.gov/geo/) under accession number GSE112549. 114Quantitative PCR analysis. We isolated total cellular RNA from sorted small pre-B cells and 115 splenic IgM + B cells using mirVana Kits. We performed reverse transcription using PrimeScript™ 116 AGCATGGTCTGAGCACCGAGTAAAGG-3'. 130 PCR analysis of Igκ rearrangement. We performed semi-quantitative PCR assay with reverse 131 transcribed cDNA using an updated protocol (26). Instead of genomic DNA, we performed PCR 132 assays from cDNA using Vk-FW (AGCTTCAGTGGCAGTGGRTCWGGRAC) and Ck 133 (CTTCCACTTGACATTGATGTC) primers, which target rearranged Vκ-Jκ transcripts. We 134 sorted small pre-B cells from WT and Ddx3x mice. cDNA from WT splenic IgM + B cells was 135 used as a positive control. B2m was amplified as an internal control. PCR products were evaluated 136 on 1% agarose gel and quantified using ImageLab software (BIO-RAD). The intensity of the band 137 for each rearrangement product (Vκ-Jκ1/2/4/5) was divided by that of the corresponding B2m band, 138 and the resulting value was then normalized to the values obtained from IgM + B cells. 139