Ddx3xregulates B-cell development and light chain recombination in mice

Abstract

35Ddx3x encodes a DEAD box RNA helicase implicated in antiviral immunity and tumorigenesis. 36We find that hematopoietic Ddx3x deficiency in Vav1-Cre mice (Ddx3x) results in altered 37 leukocyte composition of secondary lymphoid tissues, including a marked reduction in mature B 38 cells. This paucity of peripheral B cells is associated with deficits in B-cell development in the 39 bone marrow, including reduced frequencies of small pre-B cells. Bone marrow chimera 40 experiments reveal a B-cell intrinsic effect of Ddx3x deletion. Mechanistically, Ddx3x small pre-41 B cells exhibit lower expression of Brwd1, a histone reader that restricts recombination at the 42 immunoglobulin kappa (Igk) locus. In fact, the B-cell deficits in Ddx3x mice resemble those of 43 Brwd1 mutant mice, and both strains of mice exhibit defective Igk rearrangement in small pre-B 44 cells. The contribution of Ddx3x to Brwd1 expression and light chain rearrangement constitutes 45 the first evidence of a role for an RNA helicase in promoting B-cell development. 46 R software (64bit, v3.2.2). Genome data have been deposited in GEO 113 (https://www.ncbi.nlm.nih.gov/geo/) under accession number GSE112549. 114Quantitative PCR analysis. We isolated total cellular RNA from sorted small pre-B cells and 115 splenic IgM + B cells using mirVana Kits. We performed reverse transcription using PrimeScript™ 116 AGCATGGTCTGAGCACCGAGTAAAGG-3'. 130 PCR analysis of Igκ rearrangement. We performed semi-quantitative PCR assay with reverse 131 transcribed cDNA using an updated protocol (26). Instead of genomic DNA, we performed PCR 132 assays from cDNA using Vk-FW (AGCTTCAGTGGCAGTGGRTCWGGRAC) and Ck 133 (CTTCCACTTGACATTGATGTC) primers, which target rearranged Vκ-Jκ transcripts. We 134 sorted small pre-B cells from WT and Ddx3x mice. cDNA from WT splenic IgM + B cells was 135 used as a positive control. B2m was amplified as an internal control. PCR products were evaluated 136 on 1% agarose gel and quantified using ImageLab software (BIO-RAD). The intensity of the band 137 for each rearrangement product (Vκ-Jκ1/2/4/5) was divided by that of the corresponding B2m band, 138 and the resulting value was then normalized to the values obtained from IgM + B cells. 139

The RNA helicase DDX3 and its role in c-MYC driven germinal center-derived B-cell lymphoma

“…DDX3X mRNA is expressed in the germinal center specifically in light zone B cells as shown by single-cell RNA-seq analyses (82) and DDX3X protein is as well present in human and murine mature B cells (47,48). Two independent studies with several different knockout mouse models showed loss of germinal center B cells upon ablation of Ddx3x expression (47,55) and a reduction of plasmablasts (55). Overall, both studies demonstrate not only that GC B cells are impaired but also show defects several other less mature B cell populations in conditionally deficient mice when Ddx3x expression is shut down with the Vav-cre or Cd19-cre deleter (47,48,55).…”

“…Studies investigating a functional redundancy of both proteins showed that murine DDX3Y and murine D1Pas1, another DEAD-box RNA helicase, can rescue a loss of function of DDX3X in hamster cells (50). Moreover, several other reports have recently provided evidence for a compensatory effect of DDX3Y in DDX3X-deficient mice since male DDX3Xdeficient have different phenotypes compared to DDX3X-deficient females, notably in brain cells (51,52), hepatocytes (53), bonemarrow derived macrophages (54) and hematopoietic cells (47,55). It was even shown that neurons lacking DDX3X have a higher level of Ddx3y mRNA again indicating the existence of a malespecific compensation mechanism, and that both murine DDX3X and DDX3Y have indeed similar or almost identical functions (51,52).…”

“…Studies with constitutive knockout of Ddx3y in mouse demonstrated that DDX3Y cannot fully compensate for the loss of DDX3X during embryonic and neuronal development (51). In addition, while the conditional knockout of Ddx3x in hematopoietic cells was incompatible with survival for female mice, male mice survived but showed specific deficiencies, for instance in innate antimicrobial immunity or lymphopoiesis, indicating that some functional differences exist between the two proteins in adults (47,54,55). The most divergent region between the DDX3X and DDX3Y amino acid sequences is found in their N-terminal part containing the IDR1 (Figure 1) (19).…”

“…Two independent studies with several different knockout mouse models showed loss of germinal center B cells upon ablation of Ddx3x expression (47,55) and a reduction of plasmablasts (55). Overall, both studies demonstrate not only that GC B cells are impaired but also show defects several other less mature B cell populations in conditionally deficient mice when Ddx3x expression is shut down with the Vav-cre or Cd19-cre deleter (47,48,55). DDX3X deficiency generated with the Vav-cre deleter altered hematopoietic progenitors, early B and T cell development and affected marginal zone B cells (47).…”