Management of geminiviruses is a worldwide challenge because of the widespread distribution of economically important diseases caused by these viruses. Regardless of the type of agriculture, management is most effective with an integrated pest management (IPM) approach that involves measures before, during, and after the growing season. This includes starting with resistant cultivars and virus- and vector-free transplants and propagative plants. For high value vegetables, protected culture (e.g., greenhouses and screenhouses) allows for effective management but is limited owing to high cost. Protection of young plants in open fields is provided by row covers, but other measures are typically required. Measures that are used for crops in open fields include roguing infected plants and insect vector management. Application of insecticide to manage vectors (whiteflies and leafhoppers) is the most widely used measure but can cause undesirable environmental and human health issues. For annual crops, these measures can be more effective when combined with host-free periods of two to three months. Finally, given the great diversity of the viruses, their insect vectors, and the crops affected, IPM approaches need to be based on the biology and ecology of the virus and vector and the crop production system. Here, we present the general measures that can be used in an IPM program for geminivirus diseases, specific case studies, and future challenges.
A new begomovirus species was identified from tomato plants with upward leaf curling and purple vein symptoms, which was first identified in the Piaui state of Northeast (NE) Brazil in 2014. Tomato leaf samples were collected in 2014 and 2016, and PCR with degenerate primers revealed begomovirus infection. Rolling circle amplification and restriction enzyme digestion indicated a single genomic DNA of ~ 2.6 kb. Cloning and sequencing revealed a genome organization similar to DNA-A components of New World (NW) bipartite begomoviruses, with no DNA-B. The complete nucleotide sequence had the highest identity (80%) with the DNA-A of Macroptilium yellow spot virus (MacYSV), and phylogenetic analyses showed it is a NW begomovirus that clusters with MacYSV and Blainvillea yellow spot virus, also from NE Brazil. Tomato plants agroinoculated with a dimeric clone of this genomic DNA developed upward leaf curling and purple vein symptoms, indistinguishable from those observed in the field. Based on agroinoculation, this virus has a narrow host range, mainly within the family Solanaceae. Co-inoculation experiments with tomato severe rugose virus and tomato mottle leaf curl virus, the two predominant begomoviruses infecting tomato in Brazil, revealed a synergistic interaction among these begomoviruses. The name Tomato leaf curl purple vein virus (ToLCPVV) is proposed for this new begomovirus.
Watermelon (Citrullus lanatus) is an important crop in Brazil both for export and domestic consumption. In this study, the cause of a severe leaf curling, distortions and vein clearing/yellowing disease of watermelon was investigated by high-throughput sequencing (HTS). The RNA extract of virus semi-purification preparation (Blawid et al., 2017) from leaf samples of 10 symptomatic plants collected from a commercial field in Juazeiro, Bahia state in May 2019, were pooled. Then, cDNA prepared with TruSeq Stranded Total RNA with Ribo-Zero Plant Kit (Illumina, San Diego, USA) was analyzed by HTS using Novaseq with 100 paired ends of 3G scale (~31M reads). De novo assembly of total reads was performed using Megahit (Li et al., 2015), and the tBlastX search against the RefSeq Virus Genomes (NCBI) was done using Geneious 11.1 program (Biomatters, Auckland, New Zealand). Reads of groundnut ringspot virus (GRSV) were identified, in addition to those of watermelon crinkle leaf-associated virus 1 (WCLaV-1, LC636070-72) and 2 (WCLaV-2, LC636073-75), which are putative members of the genus Coguvirus in the family Phenuiviridae (Zhang et al. 2021) and have not been reported in Brazil. Other plant viruses were not found. The means of read coverage over the genes were from 1652 to 2532 for WCLaV-1 and from 404 to 1025 for WCLaV-2. These viruses were recently reported infecting watermelon in China (Xin et al., 2017) and the USA (Hernandez et al., 2021). The nucleotide identities between consensus sequences of isolates from Brazil and reference sequences of the WCLaV-1 KF-1 isolate from China (KY781184-86) were 99.0% in RdRp, 98.9% in nucleocapsid (NC) and 99.1% in putative movement protein (MP) genes, and between the WCLaV-2 KF-15 isolate from China (MW559083-91) and the sequences from Brazil, 97.2% in RdRp, 96.6% in NC and 96.9% in putative MP genes. To confirm the presence of these viruses in individual samples, RT-PCR was conducted with specific primers to WCLaV-1 (WCLaV-1vNP and WCLaV-1cMP) and WCLaV-2 (WCLaV-2vNP and WCLaV-2cMP) (Hernandez et al., 2021), targeting the NC protein genes with the expected amplicon sizes of 786 and 449 nt, respectively. In addition, GRSV-specific primers (GRSVS: GTGCATCATCCATTGTAAATCC and GRSVA: CGCCAAAGCATCATGAAAG), targeting the NC protein gene, with the expected amplicon size of 445 nt, were also used in the test. Twelve samples from watermelon plants with similar symptoms were analyzed by RT-PCR, six from a field in Mossoró, Rio Grande do Norte state collected in 2020, and six from the same field in Juazeiro, Bahia sampled in 2019. All plants from both locations were positive for WCLaV-1 and GRSV in RT-PCR tests, whereas two samples from Juazeiro were positive for WCLaV-2. Six cDNA fragments (two from Mossoró and two from Juazeiro for WCLaV-1 and two WCLaV-2 from Juazeiro) were sequenced (MZ819081-6) and showed very high identities within the species among them (99.8% to 100%). Finally, leaf samples were also collected from watermelon plants with these symptoms in Guadalupe County, Piaui State in 2015. An HTS analysis of this sample was conducted at the University of California Davis and revealed infection with a divergent strain of GRSV and WCLaV-1 (LC636068-9), but not WCLaV-2. The nucleotide identities between consensus sequences of isolates from Piauí and Juazeiro were 99.9% in RdRp and NC, and 100% in putative MP genes. These results indicate that WCLaV-1 and WCLaV-2 are present in Brazil in association with severe virus-like disease symptoms in watermelon plants.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.