<p><strong></strong><em>Chrysanthemum stunt viroid </em>(CSVd) merupakan salah satu viroid yang menginfeksi tanaman krisan di Indonesia. Tujuan penelitian ialah untuk mengembangkan metode deteksi CSVd secara molekuler dan mengkarakterisasi CSVd isolat Indonesia. Penelitian dilaksanakan di Laboratorium Virologi Tumbuhan, Departemen Proteksi Tanaman, Institut Pertanian Bogor, dan Rumah Kaca serta Laboratorium Virologi, Balai Penelitian Tanaman Hias, Segunung, Cianjur, Jawa Barat, dari Bulan Mei 2007 sampai dengan Juni 2008. RNA total diekstraksi dari daun tanaman krisan yang dihasilkan di rumah kaca menggunakan <em>rneasy plant mini kits</em>. Genom CSVd diamplifikasi dengan pasangan primer 5’-CAACTGAAGCTTCAACGCCTT-3’ dan 5’-AGGATTACTCCT- GTCTCGCA-3’. Suatu fragmen dengan ukuran 250 bp mengindikasikan bahwa c-DNA CSVd berhasil diamplifikasi dari tanaman krisan sakit menggunakan teknik RT-PCR. Urutan cDNA dari salah satu CSVd isolat Indonesia berhasil ditemukan dengan urutan sebagai berikut: cttaggattactcctgtctcgcaggagtggggtcctaagcctcattcga ttgcgcg aatctcgtcgtgcacttcctccagggatttccccgggggataccctgtaag- gaacttcttcgcctcatttcttttaagcagcagggttcaggagtgcaccacaggaaccacaagtaagtcccgagggaacaaaactaaggttccacgggcttactccctagcccaggtag- gctaaagaagattggaa. Urutan basa-basa tersebut memiliki tingkat kesamaan yang tinggi dengan sekuen nukleotida isolat CSVd dari Jepang, Korea, India, dan Amerika.</p><p> </p>
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.