No abstract

No abstract

In this study, we used pan RNA-seq analysis to reveal the ubiquitous existence of both 5′ and 3′ end small RNAs (5′ and 3′ sRNAs). 5′ and 3′ sRNAs alone can be used to annotate nuclear non-coding and mitochondrial genes at 1-bp resolution and identify new steady RNAs, which are usually transcribed from functional genes. Then, we provided a simple and cost effective way for the annotation of nuclear non-coding and mitochondrial genes and the identification of new steady RNAs, particularly long non-coding RNAs (lncRNAs). Using 5′ and 3′ sRNAs, the annotation of human mitochondrial was corrected and a novel ncRNA named non-coding mitochondrial RNA 1 (ncMT1) was reported for the first time in this study. We also found that most of human tRNA genes have downstream lncRNA genes as lncTRS-TGA1-1 and corrected the misunderstanding of them in previous studies. Using 5′, 3′, and intronic sRNAs, we reported for the first time that enzymatic double-stranded RNA (dsRNA) cleavage and RNA interference (RNAi) might be involved in the RNA degradation and gene expression regulation of U1 snRNA in human. We provided a different perspective on the regulation of gene expression in U1 snRNA. We also provided a novel view on cancer and virus-induced diseases, leading to find diagnostics or therapy targets from the ribonuclease III (RNase III) family and its related pathways. Our findings pave the way toward a rediscovery of dsRNA cleavage and RNAi, challenging classical theories.

In this study, we report for the first time the existence of complemented palindromic small RNAs (cpsRNAs) and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs. The first discovered 19-nt cpsRNA UUAACAAGCUUGUUAAAGA, named SARS-CoV-cpsR-19, was detected from a 22-bp DNA complemented palindrome TCTTTAACAAGCTTGTTAAAGA in the severe acute respiratory syndrome coronavirus (SARS-CoV) genome. The phylogenetic analysis supported that this DNA complemented palindrome originated from bat betacoronavirus. The results of RNA interference (RNAi) experiments showed that one 19-nt segment corresponding to SARS-CoV-cpsR-19 significantly induced cell apoptosis. Using this joint analysis of the molecular function and phylogeny, our results suggested that SARS-CoV-cpsR-19 could play a role in SARS-CoV infection or pathogenesis. The discovery of cpsRNAs has paved a way to find novel markers for pathogen detection and to reveal the mechanisms underlying infection or pathogenesis from a different point of view. Researchers can use cpsRNAs to study the infection or pathogenesis of pathogenic viruses when these viruses are not available. The discovery of psRNAs and cpsRNAs, as a novel class of small RNAs, also inspire researchers to investigate DNA palindromes and DNA complemented palindromes with lengths of psRNAs and cpsRNAs in viral genomes.

22In this study, we used pan RNA-seq analysis to reveal the ubiquitous existence of 5' end and 3' end 23 small RNAs. 5' and 3' sRNAs alone can be used to annotate mitochondrial with 1-bp resolution and nuclear 24 non-coding genes and identify new steady-state RNAs, which are usually from functional genes. Using 5', 3' 25 and intronic sRNAs, we revealed that the enzymatic dsRNA cleavage and RNAi could involve in the RNA 26 degradation and gene expression regulation of U1 snRNA in human. The further study of 5', 3' and intronic 27 sRNAs help rediscover double-stranded RNA (dsRNA) cleavage, RNA interference (RNAi) and the 28 regulation of gene expression, which challenges the classical theories. In this study, we provided a simple 29 and cost effective way for the annotation of mitochondrial and nuclear non-coding genes and the 30 identification of new steady-state RNAs, particularly long non-coding RNAs (lncRNAs). We also provided 31 a different point of view for cancer and virus, based on the new discoveries of dsRNA cleavage, RNAi and 32 the regulation of gene expression.