The aim of this study was to elucidate the epidemiology of third generation cephalosporin resistant Samonella isolates from pork of a slaughterhouse in China and the features of transferable elements carrying blaCTX-M genes. One hundred and twenty-six (7.3%) Salmonella isolates were identified; S. Derby and S. Rissen were the most two prevalent serotypes. Among these isolates 20 (15.8%) were resistant to third generation cephalosporins and nine of them carried blaCTX-M-27. S1-PFGE and replicon typing of blaCTX-M-27-carrying plasmids showed that seven were untypeable plasmids of about 104 Kb and two were IncP plasmids of about 300 Kb. Complete sequence analysis of one PBRT-untypeable plasmid showed it was a P1-like bateriophage, named SJ46, which contained a non-phage-associated region with several mobile elements, including Tn1721, ISEcp1B and IS903D. The other six 104 Kb PBRT-untypeable blaCTX-M-27-carrying plasmids also harboured the same phage-insertion region of SJ46 suggesting that they were the same P1-like bacteriophage. PFGE profiles of the parental strains revealed both potential vertical and horizontal spread of this P1-like blaCTX-M-27-containing element. Additionally, the representative gene of the P1 family bacteriophage, repL, was detected in 19.0% (24/126) of the isolates. This study indicated a potential role of P1-family bacteriophage in capture and spread of antimicrobial resistance in pathogens.

This Article contains errors in the Materials and Methods section under subheading 'Prevalence investigation of P1-like bacteriophage in Salmonella isolates' , where incorrect primers were quoted. "The presence of the insertion sequence on the other nontypeable plasmids carrying bla CTX-M-27 gene was detected using the following primers: IS-fw (AGAATCATCGC CGAAGGGCTGTAACTGGTTTT) and IS-rev (GCGAACATCATCCGTTGCACT CTCTTTGT)". should read: "The presence of the insertion sequence on the other nontypeable plasmids carrying bla CTX-M-27 gene was detected using the following primers: IR-fw-(GTTGCTGGCTGACGCCTATGAAG) and IR-rev-(ATGTTTGCCATTTCATAGGGGAG)".