The aim of this study was to elucidate the epidemiology of third generation cephalosporin resistant Samonella isolates from pork of a slaughterhouse in China and the features of transferable elements carrying blaCTX-M genes. One hundred and twenty-six (7.3%) Salmonella isolates were identified; S. Derby and S. Rissen were the most two prevalent serotypes. Among these isolates 20 (15.8%) were resistant to third generation cephalosporins and nine of them carried blaCTX-M-27. S1-PFGE and replicon typing of blaCTX-M-27-carrying plasmids showed that seven were untypeable plasmids of about 104 Kb and two were IncP plasmids of about 300 Kb. Complete sequence analysis of one PBRT-untypeable plasmid showed it was a P1-like bateriophage, named SJ46, which contained a non-phage-associated region with several mobile elements, including Tn1721, ISEcp1B and IS903D. The other six 104 Kb PBRT-untypeable blaCTX-M-27-carrying plasmids also harboured the same phage-insertion region of SJ46 suggesting that they were the same P1-like bacteriophage. PFGE profiles of the parental strains revealed both potential vertical and horizontal spread of this P1-like blaCTX-M-27-containing element. Additionally, the representative gene of the P1 family bacteriophage, repL, was detected in 19.0% (24/126) of the isolates. This study indicated a potential role of P1-family bacteriophage in capture and spread of antimicrobial resistance in pathogens.
This Article contains errors in the Materials and Methods section under subheading 'Prevalence investigation of P1-like bacteriophage in Salmonella isolates' , where incorrect primers were quoted. "The presence of the insertion sequence on the other nontypeable plasmids carrying bla CTX-M-27 gene was detected using the following primers: IS-fw (AGAATCATCGC CGAAGGGCTGTAACTGGTTTT) and IS-rev (GCGAACATCATCCGTTGCACT CTCTTTGT)". should read: "The presence of the insertion sequence on the other nontypeable plasmids carrying bla CTX-M-27 gene was detected using the following primers: IR-fw-(GTTGCTGGCTGACGCCTATGAAG) and IR-rev-(ATGTTTGCCATTTCATAGGGGAG)".
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.